Incidental Mutation 'R0571:D130052B06Rik'
Institutional Source Beutler Lab
Gene Symbol D130052B06Rik
Ensembl Gene ENSMUSG00000073052
Gene NameRIKEN cDNA D130052B06 gene
MMRRC Submission 038762-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R0571 (G1)
Quality Score225
Status Validated
Chromosomal Location33599302-33625618 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 33623922 bp
Amino Acid Change Arginine to Histidine at position 173 (R173H)
Ref Sequence ENSEMBL: ENSMUSP00000098922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101371]
Predicted Effect probably benign
Transcript: ENSMUST00000101371
AA Change: R173H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000098922
Gene: ENSMUSG00000073052
AA Change: R173H

low complexity region 1 12 N/A INTRINSIC
low complexity region 20 28 N/A INTRINSIC
internal_repeat_2 36 101 5.51e-11 PROSPERO
internal_repeat_1 68 122 4.83e-23 PROSPERO
internal_repeat_2 99 175 5.51e-11 PROSPERO
internal_repeat_1 122 176 4.83e-23 PROSPERO
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.7%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,259,793 D2909G unknown Het
Abhd4 C T 14: 54,263,249 T165I possibly damaging Het
Acsl5 A G 19: 55,288,911 probably benign Het
Actl6b C A 5: 137,566,784 probably benign Het
Atg13 T C 2: 91,678,718 probably benign Het
Cabyr A G 18: 12,750,852 E132G probably damaging Het
Cadps2 C T 6: 23,583,412 V389I probably damaging Het
Capn2 C T 1: 182,470,760 V647I probably benign Het
Card10 G T 15: 78,787,401 P621Q possibly damaging Het
Catsperb C G 12: 101,602,774 H902D possibly damaging Het
Cers3 A G 7: 66,786,057 M255V possibly damaging Het
Cfh T C 1: 140,102,333 probably null Het
Chd3 A C 11: 69,361,669 probably null Het
Chpf2 G T 5: 24,590,427 R316L probably damaging Het
Clca1 T A 3: 145,007,789 N694Y probably damaging Het
Ctbp2 G A 7: 133,014,805 L44F probably damaging Het
Cttnbp2 T C 6: 18,381,103 M1365V probably benign Het
Dchs1 A G 7: 105,771,996 F406L probably damaging Het
Ddx43 T A 9: 78,413,863 N384K possibly damaging Het
Drd5 G A 5: 38,319,927 V88M probably damaging Het
Eefsec A T 6: 88,297,899 F361Y probably benign Het
Epb41 T C 4: 131,989,904 D313G probably damaging Het
Etl4 T C 2: 20,743,769 M104T probably damaging Het
Fabp7 A T 10: 57,785,541 T37S probably benign Het
Fam186b T C 15: 99,286,953 T30A probably benign Het
Fam83d G A 2: 158,785,691 W433* probably null Het
Fmnl2 A T 2: 53,054,491 T161S probably benign Het
Ghsr C T 3: 27,372,016 R74C probably damaging Het
Gm6990 G A 19: 56,755,243 noncoding transcript Het
Gtf3c3 C T 1: 54,417,778 A488T probably damaging Het
Gtpbp4 A T 13: 8,990,686 probably benign Het
Hamp2 A G 7: 30,924,086 L17P possibly damaging Het
Heatr1 C A 13: 12,430,240 S1581R probably damaging Het
Hpf1 T C 8: 60,900,113 V176A probably benign Het
Hydin T A 8: 110,514,103 probably null Het
Ighg2c G A 12: 113,288,762 Q57* probably null Het
Itgb4 A G 11: 115,979,768 N141S possibly damaging Het
Kif13b G T 14: 64,751,528 R786L probably damaging Het
Lhx3 C A 2: 26,201,124 W391L probably damaging Het
Map1s T A 8: 70,912,907 V152D probably damaging Het
Map4 T C 9: 110,036,766 M608T probably benign Het
Mb21d2 G A 16: 28,929,572 A31V probably benign Het
Mfn1 T C 3: 32,561,472 I328T probably damaging Het
Myh4 A T 11: 67,250,331 I740F possibly damaging Het
Neo1 A G 9: 58,985,786 V191A probably benign Het
Nfatc4 T C 14: 55,830,028 V565A probably damaging Het
Nrxn2 G C 19: 6,473,533 E525D probably damaging Het
Olfr361 T C 2: 37,085,334 H138R probably benign Het
Pcdhb12 A T 18: 37,437,208 D469V probably damaging Het
Pcdhb6 G T 18: 37,335,114 V363L probably benign Het
Pkd1l2 T C 8: 117,082,218 T78A probably benign Het
Primpol T G 8: 46,581,639 D418A probably damaging Het
Rbm12b1 G A 4: 12,146,248 S740N probably benign Het
Rpe65 T C 3: 159,600,349 L15P probably damaging Het
Sectm1a A G 11: 121,069,102 probably benign Het
Sft2d1 C A 17: 8,326,950 probably benign Het
Slc22a18 A G 7: 143,491,861 probably benign Het
Slu7 G A 11: 43,441,578 probably null Het
Smc4 T C 3: 69,024,289 V572A probably damaging Het
Spire2 T A 8: 123,354,116 I33N probably damaging Het
Tbck T A 3: 132,752,642 C678S probably damaging Het
Tnrc6b T C 15: 80,913,338 V1362A probably damaging Het
Ttn T C 2: 76,739,982 K25110E possibly damaging Het
Ugt2b35 A G 5: 87,000,934 S15G possibly damaging Het
Upf3a T A 8: 13,792,184 I200K probably damaging Het
Vill G C 9: 119,070,633 G295A possibly damaging Het
Vmn1r191 A T 13: 22,179,047 V179D probably damaging Het
Vmn2r74 T C 7: 85,952,421 T670A probably damaging Het
Zfp169 T C 13: 48,489,690 T654A possibly damaging Het
Zfp646 A G 7: 127,881,966 E1105G probably damaging Het
Zyg11b A T 4: 108,260,042 Y334N probably damaging Het
Other mutations in D130052B06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:D130052B06Rik APN 11 33623558 missense possibly damaging 0.62
IGL00508:D130052B06Rik APN 11 33599402 missense unknown
IGL01152:D130052B06Rik APN 11 33623620 splice site probably null
IGL01744:D130052B06Rik APN 11 33623966 missense unknown
IGL02829:D130052B06Rik APN 11 33623864 missense probably benign 0.16
IGL02882:D130052B06Rik APN 11 33623780 missense probably damaging 0.99
R0396:D130052B06Rik UTSW 11 33623391 missense unknown
R1467:D130052B06Rik UTSW 11 33623622 splice site probably benign
R1706:D130052B06Rik UTSW 11 33616230 missense unknown
R1733:D130052B06Rik UTSW 11 33623784 missense probably benign 0.16
R6029:D130052B06Rik UTSW 11 33623477 missense possibly damaging 0.62
R6045:D130052B06Rik UTSW 11 33624008 missense unknown
R6269:D130052B06Rik UTSW 11 33623916 missense possibly damaging 0.92
R7238:D130052B06Rik UTSW 11 33623594 missense probably benign 0.01
R7240:D130052B06Rik UTSW 11 33623874 missense possibly damaging 0.79
R7305:D130052B06Rik UTSW 11 33623355 frame shift probably null
Predicted Primers PCR Primer
(R):5'- CATAGCAACAGAAATAAAACaggaacagtgag -3'

Sequencing Primer
(R):5'- tctctattctccttttattccccc -3'
Posted On2013-06-11