Mutagenetix > Incidental Mutation

Incidental Mutation 'R0571:Tnrc6b'

46489

Institutional Source

Beutler Lab

Gene Symbol

Tnrc6b

Ensembl Gene

ENSMUSG00000047888

Gene Name

trinucleotide repeat containing 6b

Synonyms

MMRRC Submission

038762-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.168) question?

Stock #

R0571 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80711313-80941085 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 80913338 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1362 (V1362A)

Ref Sequence

ENSEMBL: ENSMUSP00000064336 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067689]

AlphaFold

Q8BKI2

Predicted Effect

probably damaging
Transcript: ENSMUST00000067689
AA Change: V1362A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000064336
Gene: ENSMUSG00000047888
AA Change: V1362A

Domain	Start	End	E-Value	Type
low complexity region	7	19	N/A	INTRINSIC
coiled coil region	33	72	N/A	INTRINSIC
low complexity region	88	106	N/A	INTRINSIC
low complexity region	155	174	N/A	INTRINSIC
low complexity region	207	220	N/A	INTRINSIC
low complexity region	242	260	N/A	INTRINSIC
low complexity region	331	346	N/A	INTRINSIC
low complexity region	363	380	N/A	INTRINSIC
low complexity region	416	425	N/A	INTRINSIC
low complexity region	475	487	N/A	INTRINSIC
internal_repeat_1	488	667	6.43e-5	PROSPERO
low complexity region	858	888	N/A	INTRINSIC
Pfam:Ago_hook	955	1095	1.2e-28	PFAM
coiled coil region	1258	1307	N/A	INTRINSIC
Pfam:TNRC6-PABC_bdg	1339	1623	2.8e-112	PFAM
Pfam:RRM_5	1641	1695	2e-7	PFAM
low complexity region	1705	1721	N/A	INTRINSIC
low complexity region	1748	1769	N/A	INTRINSIC
low complexity region	1792	1809	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226442

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228071

Predicted Effect

unknown
Transcript: ENSMUST00000228124
AA Change: V509A

Meta Mutation Damage Score

0.1716

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 96.9%
20x: 94.7%

Validation Efficiency

100% (71/71)

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trap allele exhibit neonatal and postnatal lethality with decreased body weight and infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	A	G	15: 8,259,793	D2909G	unknown	Het
Abhd4	C	T	14: 54,263,249	T165I	possibly damaging	Het
Acsl5	A	G	19: 55,288,911		probably benign	Het
Actl6b	C	A	5: 137,566,784		probably benign	Het
Atg13	T	C	2: 91,678,718		probably benign	Het
Cabyr	A	G	18: 12,750,852	E132G	probably damaging	Het
Cadps2	C	T	6: 23,583,412	V389I	probably damaging	Het
Capn2	C	T	1: 182,470,760	V647I	probably benign	Het
Card10	G	T	15: 78,787,401	P621Q	possibly damaging	Het
Catsperb	C	G	12: 101,602,774	H902D	possibly damaging	Het
Cers3	A	G	7: 66,786,057	M255V	possibly damaging	Het
Cfh	T	C	1: 140,102,333		probably null	Het
Chd3	A	C	11: 69,361,669		probably null	Het
Chpf2	G	T	5: 24,590,427	R316L	probably damaging	Het
Clca1	T	A	3: 145,007,789	N694Y	probably damaging	Het
Ctbp2	G	A	7: 133,014,805	L44F	probably damaging	Het
Cttnbp2	T	C	6: 18,381,103	M1365V	probably benign	Het
D130052B06Rik	G	A	11: 33,623,922	R173H	probably benign	Het
Dchs1	A	G	7: 105,771,996	F406L	probably damaging	Het
Ddx43	T	A	9: 78,413,863	N384K	possibly damaging	Het
Drd5	G	A	5: 38,319,927	V88M	probably damaging	Het
Eefsec	A	T	6: 88,297,899	F361Y	probably benign	Het
Epb41	T	C	4: 131,989,904	D313G	probably damaging	Het
Etl4	T	C	2: 20,743,769	M104T	probably damaging	Het
Fabp7	A	T	10: 57,785,541	T37S	probably benign	Het
Fam186b	T	C	15: 99,286,953	T30A	probably benign	Het
Fam83d	G	A	2: 158,785,691	W433*	probably null	Het
Fmnl2	A	T	2: 53,054,491	T161S	probably benign	Het
Ghsr	C	T	3: 27,372,016	R74C	probably damaging	Het
Gm6990	G	A	19: 56,755,243		noncoding transcript	Het
Gtf3c3	C	T	1: 54,417,778	A488T	probably damaging	Het
Gtpbp4	A	T	13: 8,990,686		probably benign	Het
Hamp2	A	G	7: 30,924,086	L17P	possibly damaging	Het
Heatr1	C	A	13: 12,430,240	S1581R	probably damaging	Het
Hpf1	T	C	8: 60,900,113	V176A	probably benign	Het
Hydin	T	A	8: 110,514,103		probably null	Het
Ighg2c	G	A	12: 113,288,762	Q57*	probably null	Het
Itgb4	A	G	11: 115,979,768	N141S	possibly damaging	Het
Kif13b	G	T	14: 64,751,528	R786L	probably damaging	Het
Lhx3	C	A	2: 26,201,124	W391L	probably damaging	Het
Map1s	T	A	8: 70,912,907	V152D	probably damaging	Het
Map4	T	C	9: 110,036,766	M608T	probably benign	Het
Mb21d2	G	A	16: 28,929,572	A31V	probably benign	Het
Mfn1	T	C	3: 32,561,472	I328T	probably damaging	Het
Myh4	A	T	11: 67,250,331	I740F	possibly damaging	Het
Neo1	A	G	9: 58,985,786	V191A	probably benign	Het
Nfatc4	T	C	14: 55,830,028	V565A	probably damaging	Het
Nrxn2	G	C	19: 6,473,533	E525D	probably damaging	Het
Olfr361	T	C	2: 37,085,334	H138R	probably benign	Het
Pcdhb12	A	T	18: 37,437,208	D469V	probably damaging	Het
Pcdhb6	G	T	18: 37,335,114	V363L	probably benign	Het
Pkd1l2	T	C	8: 117,082,218	T78A	probably benign	Het
Primpol	T	G	8: 46,581,639	D418A	probably damaging	Het
Rbm12b1	G	A	4: 12,146,248	S740N	probably benign	Het
Rpe65	T	C	3: 159,600,349	L15P	probably damaging	Het
Rxrb	CGCGGCGGCGGCGGCGGCGGC	CGCGGCGGCGGCGGCGGC	17: 34,032,132		probably benign	Het
Sectm1a	A	G	11: 121,069,102		probably benign	Het
Sft2d1	C	A	17: 8,326,950		probably benign	Het
Slc22a18	A	G	7: 143,491,861		probably benign	Het
Slu7	G	A	11: 43,441,578		probably null	Het
Smc4	T	C	3: 69,024,289	V572A	probably damaging	Het
Spire2	T	A	8: 123,354,116	I33N	probably damaging	Het
Tbck	T	A	3: 132,752,642	C678S	probably damaging	Het
Ttn	T	C	2: 76,739,982	K25110E	possibly damaging	Het
Ugt2b35	A	G	5: 87,000,934	S15G	possibly damaging	Het
Upf3a	T	A	8: 13,792,184	I200K	probably damaging	Het
Vill	G	C	9: 119,070,633	G295A	possibly damaging	Het
Vmn1r191	A	T	13: 22,179,047	V179D	probably damaging	Het
Vmn2r74	T	C	7: 85,952,421	T670A	probably damaging	Het
Zfp169	T	C	13: 48,489,690	T654A	possibly damaging	Het
Zfp646	A	G	7: 127,881,966	E1105G	probably damaging	Het
Zyg11b	A	T	4: 108,260,042	Y334N	probably damaging	Het

Other mutations in Tnrc6b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01312:Tnrc6b	APN	15	80923578	missense	probably damaging	1.00
IGL01402:Tnrc6b	APN	15	80880544	missense	possibly damaging	0.71
IGL01505:Tnrc6b	APN	15	80879963	missense	probably benign	0.00
IGL01516:Tnrc6b	APN	15	80902622	missense	possibly damaging	0.93
IGL01584:Tnrc6b	APN	15	80879682	missense	probably benign	0.01
IGL01681:Tnrc6b	APN	15	80879311	splice site	probably null
IGL01909:Tnrc6b	APN	15	80901983	missense	possibly damaging	0.88
IGL01943:Tnrc6b	APN	15	80927695	nonsense	probably null
IGL02253:Tnrc6b	APN	15	80876541	missense	probably damaging	0.99
IGL02260:Tnrc6b	APN	15	80880171	missense	probably damaging	0.99
IGL02437:Tnrc6b	APN	15	80880457	missense	probably damaging	1.00
IGL02541:Tnrc6b	APN	15	80879831	missense	probably benign	0.00
IGL02542:Tnrc6b	APN	15	80902352	missense	possibly damaging	0.83
grosser	UTSW	15	80929285	missense	probably damaging	1.00
heiliger	UTSW	15	80927741	critical splice donor site	probably null
PIT1430001:Tnrc6b	UTSW	15	80929186	missense	probably damaging	0.99
R0092:Tnrc6b	UTSW	15	80918528	missense	probably damaging	1.00
R0165:Tnrc6b	UTSW	15	80858670	splice site	probably null
R0238:Tnrc6b	UTSW	15	80887864	missense	probably damaging	1.00
R0238:Tnrc6b	UTSW	15	80887864	missense	probably damaging	1.00
R0257:Tnrc6b	UTSW	15	80894355	missense	possibly damaging	0.80
R0418:Tnrc6b	UTSW	15	80913323	missense	probably benign	0.27
R0432:Tnrc6b	UTSW	15	80923446	splice site	probably benign
R0487:Tnrc6b	UTSW	15	80880675	missense	probably benign	0.01
R0498:Tnrc6b	UTSW	15	80858719	missense	probably damaging	0.98
R0528:Tnrc6b	UTSW	15	80879403	missense	probably benign	0.00
R0533:Tnrc6b	UTSW	15	80876653	missense	probably benign	0.00
R0650:Tnrc6b	UTSW	15	80784758	missense	probably benign	0.33
R0659:Tnrc6b	UTSW	15	80923446	splice site	probably benign
R0884:Tnrc6b	UTSW	15	80902555	small deletion	probably benign
R1131:Tnrc6b	UTSW	15	80894453	missense	possibly damaging	0.45
R1188:Tnrc6b	UTSW	15	80879229	missense	probably benign
R1479:Tnrc6b	UTSW	15	80887032	splice site	probably null
R1564:Tnrc6b	UTSW	15	80880168	missense	possibly damaging	0.95
R1645:Tnrc6b	UTSW	15	80882958	missense	probably damaging	0.99
R1924:Tnrc6b	UTSW	15	80884206	critical splice acceptor site	probably null
R1926:Tnrc6b	UTSW	15	80881162	missense	probably damaging	1.00
R1928:Tnrc6b	UTSW	15	80880723	missense	probably damaging	1.00
R1965:Tnrc6b	UTSW	15	80880439	missense	probably damaging	1.00
R1966:Tnrc6b	UTSW	15	80880439	missense	probably damaging	1.00
R2072:Tnrc6b	UTSW	15	80882965	missense	possibly damaging	0.89
R3084:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R3552:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R3736:Tnrc6b	UTSW	15	80889163	splice site	probably benign
R3791:Tnrc6b	UTSW	15	80923640	missense	probably damaging	1.00
R4170:Tnrc6b	UTSW	15	80916787	missense	probably benign	0.24
R4276:Tnrc6b	UTSW	15	80901971	missense	probably benign	0.42
R4519:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R5380:Tnrc6b	UTSW	15	80879565	missense	possibly damaging	0.56
R5470:Tnrc6b	UTSW	15	80916711	missense	possibly damaging	0.89
R5590:Tnrc6b	UTSW	15	80876502	missense	probably damaging	0.98
R5982:Tnrc6b	UTSW	15	80880816	missense	probably benign
R6269:Tnrc6b	UTSW	15	80880743	missense	probably benign	0.42
R6331:Tnrc6b	UTSW	15	80879614	missense	probably benign	0.00
R6484:Tnrc6b	UTSW	15	80879324	missense	possibly damaging	0.92
R6622:Tnrc6b	UTSW	15	80879184	missense	probably damaging	0.99
R6695:Tnrc6b	UTSW	15	80879773	missense	probably damaging	1.00
R6728:Tnrc6b	UTSW	15	80918526	missense	probably damaging	1.00
R6776:Tnrc6b	UTSW	15	80924119	missense	possibly damaging	0.87
R7159:Tnrc6b	UTSW	15	80887022	missense	possibly damaging	0.92
R7210:Tnrc6b	UTSW	15	80929285	missense	probably damaging	1.00
R7287:Tnrc6b	UTSW	15	80879541	missense	possibly damaging	0.83
R7402:Tnrc6b	UTSW	15	80884300	missense	probably damaging	1.00
R7479:Tnrc6b	UTSW	15	80889126	missense	probably benign	0.13
R7533:Tnrc6b	UTSW	15	80927741	critical splice donor site	probably null
R7571:Tnrc6b	UTSW	15	80929393	missense	probably benign
R7594:Tnrc6b	UTSW	15	80880307	missense	possibly damaging	0.66
R7831:Tnrc6b	UTSW	15	80880379	missense	possibly damaging	0.49
R8208:Tnrc6b	UTSW	15	80858700	missense	possibly damaging	0.53
R8276:Tnrc6b	UTSW	15	80880717	missense	probably benign	0.00
R8295:Tnrc6b	UTSW	15	80913364	missense	probably damaging	1.00
R8351:Tnrc6b	UTSW	15	80923490	missense	probably damaging	0.99
R8423:Tnrc6b	UTSW	15	80929418	missense	unknown
R8451:Tnrc6b	UTSW	15	80923490	missense	probably damaging	0.99
R8725:Tnrc6b	UTSW	15	80876452	missense	probably damaging	1.00
R8872:Tnrc6b	UTSW	15	80918089	missense	probably benign	0.23
R9029:Tnrc6b	UTSW	15	80878978	missense	possibly damaging	0.83
R9057:Tnrc6b	UTSW	15	80879148	missense	probably benign
R9240:Tnrc6b	UTSW	15	80880061	missense	probably damaging	0.98
R9450:Tnrc6b	UTSW	15	80880436	missense	probably benign	0.01
R9539:Tnrc6b	UTSW	15	80876343	missense	probably damaging	0.99
R9646:Tnrc6b	UTSW	15	80889065	missense	possibly damaging	0.89
X0020:Tnrc6b	UTSW	15	80882997	missense	probably benign	0.16
X0025:Tnrc6b	UTSW	15	80881167	missense	probably benign	0.03
Z1088:Tnrc6b	UTSW	15	80927690	nonsense	probably null
Z1177:Tnrc6b	UTSW	15	80858699	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- CACTGGAGTATCAGTGGGCTTCTTG -3'
(R):5'- GCCAACAAAACATGCAGAATACTTGGTC -3'

Sequencing Primer
(F):5'- GTCAGAGAATGGTTGAATCCCCC -3'
(R):5'- TTCTTGTGTGGCCACAGATG -3'

Posted On

2013-06-11