Incidental Mutation 'R5226:Tlx2'
ID472457
Institutional Source Beutler Lab
Gene Symbol Tlx2
Ensembl Gene ENSMUSG00000068327
Gene NameT cell leukemia, homeobox 2
SynonymsEnx, NCX, Tlx1l1, Ncx1, Hox11L.1, Hox11l1
MMRRC Submission 042799-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.738) question?
Stock #R5226 (G1)
Quality Score45
Status Validated
Chromosome6
Chromosomal Location83068324-83070293 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 83068930 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 228 (G228D)
Ref Sequence ENSEMBL: ENSMUSP00000087069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077502] [ENSMUST00000089641] [ENSMUST00000174674]
Predicted Effect probably benign
Transcript: ENSMUST00000077502
SMART Domains Protein: ENSMUSP00000076708
Gene: ENSMUSG00000009145

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
DEXDc 30 236 5.01e-4 SMART
low complexity region 268 280 N/A INTRINSIC
low complexity region 288 301 N/A INTRINSIC
HA2 441 530 4e-19 SMART
Pfam:OB_NTP_bind 555 674 2.2e-11 PFAM
low complexity region 695 708 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000089641
AA Change: G228D

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000087069
Gene: ENSMUSG00000068327
AA Change: G228D

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 25 61 N/A INTRINSIC
low complexity region 82 116 N/A INTRINSIC
HOX 157 219 1.66e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174674
SMART Domains Protein: ENSMUSP00000133420
Gene: ENSMUSG00000068327

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 25 61 N/A INTRINSIC
low complexity region 82 116 N/A INTRINSIC
HOX 157 213 2.43e-16 SMART
Meta Mutation Damage Score 0.1695 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of an orphan homeobox-containing transcription factor family. Studies of the mouse ortholog have shown that the encoded protein is crucial for the development of the enteric nervous system; in humans, loss-of-function may play a role in tumorigenesis of gastrointestinal stromal tumors. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygotes for two targeted null mutations exhibit megacolon with hyperinnervated enteric ganglia which undergo neuronal degeneration. Homozygotes for a third null mutation die in utero with defects in formation of the primitive streak and mesoderm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,294,076 K98E possibly damaging Het
4933414I15Rik A T 11: 50,942,589 M62K unknown Het
Akr1d1 T A 6: 37,536,014 probably null Het
Ankrd63 T C 2: 118,703,255 probably benign Het
Atad5 T C 11: 80,095,062 V325A probably damaging Het
Atp13a5 G T 16: 29,248,279 N1025K probably damaging Het
Atrnl1 G T 19: 57,650,335 V302L probably benign Het
Bend7 C A 2: 4,752,978 S277* probably null Het
Btnl7-ps A T 17: 34,533,287 noncoding transcript Het
Cbx4 T C 11: 119,081,928 Y207C probably damaging Het
Ctla2b C T 13: 60,896,332 W63* probably null Het
Cux1 T C 5: 136,370,173 T170A probably benign Het
Cyp3a57 T C 5: 145,365,697 V101A probably benign Het
Dao A T 5: 114,021,033 T267S probably benign Het
Dsp A G 13: 38,186,770 D883G probably damaging Het
Eif4g3 C A 4: 138,096,794 P36T possibly damaging Het
Elf3 G A 1: 135,257,239 L70F probably benign Het
Epb41l4a C T 18: 33,810,313 D510N probably damaging Het
Gcn1l1 T C 5: 115,588,067 S594P probably benign Het
Gm10722 T C 9: 3,000,937 C6R probably benign Het
Gpr132 T C 12: 112,852,148 T353A probably benign Het
Kntc1 A G 5: 123,794,172 D1343G probably benign Het
L3mbtl4 T A 17: 68,764,722 probably null Het
Lrit2 A G 14: 37,072,353 E458G probably damaging Het
Man1c1 A T 4: 134,578,369 I348N probably damaging Het
Map4k2 A G 19: 6,346,504 probably benign Het
Nt5c2 A C 19: 46,898,629 Y203D probably damaging Het
Oxgr1 A G 14: 120,022,253 S181P probably damaging Het
Parn A G 16: 13,625,552 C400R probably benign Het
Pcdhgb7 T C 18: 37,752,524 V249A probably benign Het
Pdzrn3 C T 6: 101,153,311 D515N probably damaging Het
Plcg2 A T 8: 117,577,874 I273F possibly damaging Het
Plin1 A G 7: 79,722,699 V64A probably damaging Het
Ppfia4 C A 1: 134,304,286 probably null Het
Prkg2 A C 5: 98,976,462 D376E possibly damaging Het
Ptgir T A 7: 16,908,720 I82N probably damaging Het
Pum2 C T 12: 8,713,458 P205L possibly damaging Het
Rab26 T A 17: 24,534,133 probably benign Het
Recql4 T C 15: 76,710,129 E63G probably benign Het
Rora T A 9: 69,364,141 probably benign Het
Rp1 A C 1: 4,348,033 M952R probably benign Het
Rpap3 T A 15: 97,703,223 R44S possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Slc12a2 C A 18: 57,879,020 P72T probably damaging Het
Slc1a3 C T 15: 8,642,225 V416M probably damaging Het
Slfn4 A T 11: 83,187,549 M388L possibly damaging Het
Snrnp48 G A 13: 38,205,117 A49T probably benign Het
Tctex1d4 A G 4: 117,128,093 T38A possibly damaging Het
Tmem132a A G 19: 10,867,144 V30A possibly damaging Het
Tnfrsf23 C A 7: 143,685,785 L24F possibly damaging Het
Ubr2 A T 17: 46,983,270 N312K probably benign Het
Vmn1r115 C T 7: 20,844,244 V248I probably damaging Het
Vmn2r80 A G 10: 79,194,040 T567A probably benign Het
Vps13c A G 9: 67,945,553 T2372A probably benign Het
Wnt10b G T 15: 98,776,614 H81N probably damaging Het
Zfp948 A G 17: 21,588,243 T566A probably benign Het
Other mutations in Tlx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4604:Tlx2 UTSW 6 83068760 makesense probably null
R4757:Tlx2 UTSW 6 83069919 missense probably benign 0.01
R5670:Tlx2 UTSW 6 83069826 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TGACCAAAGAGCCTCAGAGG -3'
(R):5'- CTTCTTGCGCCAGAAGTACCTG -3'

Sequencing Primer
(F):5'- ACTCTTCGCTGGCGGTAC -3'
(R):5'- AGAAGTACCTGGCCTCCG -3'
Posted On2017-04-06