Incidental Mutation 'LCD18:Olfr313'
Institutional Source Beutler Lab
Gene Symbol Olfr313
Ensembl Gene ENSMUSG00000070438
Gene Nameolfactory receptor 313
SynonymsGA_x6K02T2NKPP-590035-589109, MOR222-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #LCD18 (G1)
Quality Score179
Status Validated
Chromosomal Location58815000-58819450 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58817440 bp
Amino Acid Change Valine to Aspartic acid at position 144 (V144D)
Ref Sequence ENSEMBL: ENSMUSP00000150529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082220] [ENSMUST00000217506]
Predicted Effect possibly damaging
Transcript: ENSMUST00000082220
AA Change: V144D

PolyPhen 2 Score 0.797 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080852
Gene: ENSMUSG00000070438
AA Change: V144D

Pfam:7tm_4 29 306 1e-51 PFAM
Pfam:7TM_GPCR_Srsx 33 217 4.5e-9 PFAM
Pfam:7tm_1 39 288 5.2e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000217506
AA Change: V144D

PolyPhen 2 Score 0.797 (Sensitivity: 0.84; Specificity: 0.93)
Meta Mutation Damage Score 0.1768 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 88% (169/191)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik G A 5: 98,707,508 probably benign Het
4930548H24Rik GAGAAG GAG 5: 31,487,373 probably benign Het
9530077C05Rik N 9: 22,442,083 probably benign Het
A330008L17Rik A G 8: 99,723,425 noncoding transcript Het
Aaed1 G A 13: 64,287,285 probably benign Het
Aff2 C A X: 69,747,535 probably benign Het
Aldh1a1 C A 19: 20,626,646 probably benign Het
Anxa7 C T 14: 20,469,411 G113E probably damaging Het
Apba2 A T 7: 64,622,160 probably benign Het
Apc2 G C 10: 80,299,974 probably benign Het
App C G 16: 85,025,412 probably benign Het
Asic2 C A 11: 80,985,744 probably benign Het
Btk T C X: 134,578,825 probably benign Het
Car12 C A 9: 66,761,676 probably benign Het
Ccdc191 G A 16: 43,921,801 probably benign Het
Ccdc34 N 2: 110,016,318 probably benign Het
Cd164 G T 10: 41,521,926 A59S probably benign Het
Cd22 C T 7: 30,878,082 R2H possibly damaging Het
Cdv3 A T 9: 103,365,343 probably benign Het
Cdv3 C A 9: 103,365,354 probably benign Het
Celf2 N 2: 6,779,076 probably benign Het
Clec18a C A 8: 111,076,136 probably benign Het
Cnpy3 GGATGGAT GGATAGATAGATAGATAGATGGAT 17: 46,737,536 probably benign Het
Cntn4 A G 6: 106,553,940 probably benign Het
Cntnap5c G C 17: 58,162,160 probably benign Het
Col2a1 C A 15: 97,988,981 probably null Het
Cpne3 G T 4: 19,563,382 probably benign Het
Dab1 T G 4: 104,046,572 probably benign Het
Dapp1 G A 3: 137,939,400 probably benign Het
Dcc G A 18: 72,297,447 probably benign Het
Dcun1d1 GAAAAAAAAA GAAAAAAAAAA 3: 35,938,005 probably benign Het
Dennd1b G A 1: 139,114,764 probably benign Het
Dhdds TAA TA 4: 133,970,363 probably benign Het
Dnah12 G T 14: 26,849,385 G2817V probably damaging Het
Dock10 N 1: 80,716,623 probably benign Het
Dusp10 G T 1: 184,037,056 C73F probably damaging Het
Fgf20 A C 8: 40,292,318 probably benign Het
Ftsj3 G T 11: 106,250,059 probably benign Het
Gls T G 1: 52,183,367 probably benign Het
Gm12130 T C 11: 38,506,923 noncoding transcript Het
Gm12394 T C 4: 42,792,885 T416A probably benign Het
Gm14936 G A X: 112,998,750 noncoding transcript Het
Gm16630 C T 6: 48,141,269 noncoding transcript Het
Gm26917 C G 17: 39,843,971 noncoding transcript Het
Gm37311 G A 16: 77,618,281 noncoding transcript Het
Gm42418 T C 17: 39,848,555 noncoding transcript Het
Gm4302 T C 10: 100,341,444 W197R probably benign Het
Gm5615 T C 9: 36,533,553 probably benign Het
H2-Q4 G A 17: 35,380,405 D155N probably damaging Het
H2-T23 T C 17: 36,031,216 probably benign Het
Hgs CTTTTTTT CTTTTTT 11: 120,469,578 probably benign Het
Ighv5-9 C T 12: 113,661,877 S82N probably benign Het
Il1rap C A 16: 26,631,593 probably benign Het
Inhbc N 10: 127,367,140 probably benign Het
Inpp4b C T 8: 81,693,010 probably benign Het
Kars N 8: 111,993,708 probably benign Het
Kcng4 G T 8: 119,633,519 Y39* probably null Het
Kcnh7 A G 2: 63,049,799 probably benign Het
Klhl1 G C 14: 96,317,730 probably benign Het
Lrch1 C T 14: 74,905,021 probably benign Het
Lrp1b G C 2: 42,237,562 probably benign Het
Lsm8 G A 6: 18,844,316 probably benign Het
Lsm8 G A 6: 18,854,321 probably benign Het
Magi2 T C 5: 19,954,511 probably benign Het
Mef2c G A 13: 83,605,823 probably benign Het
Mei4 A G 9: 82,186,959 probably benign Het
Mid1 T A X: 170,005,564 probably benign Het
Mndal G C 1: 173,880,218 probably benign Het
Mpped2 C A 2: 106,721,428 probably benign Het
Mtf1 A G 4: 124,829,316 probably benign Het
Mxd1 T C 6: 86,667,406 probably benign Het
Nbea G T 3: 55,701,527 probably benign Het
Ncor1 N 11: 62,419,782 probably benign Het
Nox4 A G 7: 87,243,067 probably benign Het
Ocln C T 13: 100,520,567 probably benign Het
Ofcc1 G A 13: 40,092,967 probably benign Het
Paics N 5: 76,956,744 probably null Het
Paqr8 G T 1: 20,914,658 probably benign Het
Pdss1 C T 2: 22,900,968 probably benign Het
Piezo1 G A 8: 122,495,569 R503W probably damaging Het
Pkhd1 G A 1: 20,611,414 probably benign Het
Ppp1r3f C A X: 7,560,336 G562V probably damaging Het
Prr16 C T 18: 51,200,324 probably benign Het
Prss38 T G 11: 59,375,641 probably benign Het
Ptprk T C 10: 28,574,987 probably benign Het
Pum1 N 4: 130,730,549 probably benign Het
Rabgef1 N 5: 130,187,586 probably null Het
Rgs16 G A 1: 153,744,230 probably benign Het
Riok3 G T 18: 12,129,982 probably benign Het
Robo2 N 16: 74,055,954 probably benign Het
Rps6ka3 A G X: 159,279,215 probably benign Het
Rptn T A 3: 93,397,541 L727Q probably benign Het
Slc25a46 C A 18: 31,597,313 probably benign Het
Spsb1 C T 4: 149,952,486 probably benign Het
Tbc1d19 A C 5: 53,816,709 probably benign Het
Trav7-4 C T 14: 53,461,518 L41F probably benign Het
Trip12 N 1: 84,754,482 probably benign Het
Ttc13 G A 8: 124,675,866 probably benign Het
Ttll6 C T 11: 96,155,258 probably benign Het
Unc5b C G 10: 60,786,171 probably benign Het
Vmn2r87 C T 10: 130,478,714 M334I probably benign Het
Vps13b G T 15: 35,846,957 A2629S probably damaging Het
Wars2 N 3: 99,214,774 probably null Het
Zfp26 C A 9: 20,438,546 A241S probably benign Het
Zfp442 C T 2: 150,419,848 probably benign Het
Zfp808 C T 13: 62,166,651 probably benign Het
Other mutations in Olfr313
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4548:Olfr313 UTSW 11 58817440 missense possibly damaging 0.80
FR4976:Olfr313 UTSW 11 58817440 missense possibly damaging 0.80
R0269:Olfr313 UTSW 11 58817149 missense probably damaging 1.00
R0617:Olfr313 UTSW 11 58817149 missense probably damaging 1.00
R0707:Olfr313 UTSW 11 58817751 missense probably damaging 1.00
R2917:Olfr313 UTSW 11 58817488 missense probably damaging 1.00
R3085:Olfr313 UTSW 11 58817727 missense probably damaging 1.00
R4245:Olfr313 UTSW 11 58817778 missense probably damaging 1.00
R4991:Olfr313 UTSW 11 58817718 missense probably damaging 1.00
R5188:Olfr313 UTSW 11 58817320 missense probably damaging 0.96
R6985:Olfr313 UTSW 11 58817113 missense probably damaging 0.98
R7076:Olfr313 UTSW 11 58817164 missense probably benign 0.17
R7253:Olfr313 UTSW 11 58817540 nonsense probably null
R7553:Olfr313 UTSW 11 58817060 missense probably benign 0.10
R8204:Olfr313 UTSW 11 58817059 missense probably benign 0.05
Z1186:Olfr313 UTSW 11 58817061 missense probably benign
Z1186:Olfr313 UTSW 11 58817296 missense probably benign
Z1186:Olfr313 UTSW 11 58817394 missense probably benign
Z1186:Olfr313 UTSW 11 58817682 missense probably benign
Z1186:Olfr313 UTSW 11 58817818 missense probably benign
Z1187:Olfr313 UTSW 11 58817061 missense probably benign
Z1187:Olfr313 UTSW 11 58817296 missense probably benign
Z1187:Olfr313 UTSW 11 58817394 missense probably benign
Z1187:Olfr313 UTSW 11 58817417 missense probably benign
Z1187:Olfr313 UTSW 11 58817682 missense probably benign
Z1187:Olfr313 UTSW 11 58817818 missense probably benign
Z1188:Olfr313 UTSW 11 58817061 missense probably benign
Z1188:Olfr313 UTSW 11 58817296 missense probably benign
Z1188:Olfr313 UTSW 11 58817394 missense probably benign
Z1188:Olfr313 UTSW 11 58817417 missense probably benign
Z1188:Olfr313 UTSW 11 58817682 missense probably benign
Z1188:Olfr313 UTSW 11 58817818 missense probably benign
Z1189:Olfr313 UTSW 11 58817061 missense probably benign
Z1189:Olfr313 UTSW 11 58817296 missense probably benign
Z1189:Olfr313 UTSW 11 58817394 missense probably benign
Z1189:Olfr313 UTSW 11 58817682 missense probably benign
Z1189:Olfr313 UTSW 11 58817818 missense probably benign
Z1190:Olfr313 UTSW 11 58817061 missense probably benign
Z1190:Olfr313 UTSW 11 58817296 missense probably benign
Z1190:Olfr313 UTSW 11 58817394 missense probably benign
Z1190:Olfr313 UTSW 11 58817417 missense probably benign
Z1190:Olfr313 UTSW 11 58817682 missense probably benign
Z1190:Olfr313 UTSW 11 58817818 missense probably benign
Z1191:Olfr313 UTSW 11 58817061 missense probably benign
Z1191:Olfr313 UTSW 11 58817296 missense probably benign
Z1191:Olfr313 UTSW 11 58817394 missense probably benign
Z1191:Olfr313 UTSW 11 58817417 missense probably benign
Z1191:Olfr313 UTSW 11 58817682 missense probably benign
Z1191:Olfr313 UTSW 11 58817818 missense probably benign
Z1192:Olfr313 UTSW 11 58817061 missense probably benign
Z1192:Olfr313 UTSW 11 58817296 missense probably benign
Z1192:Olfr313 UTSW 11 58817394 missense probably benign
Z1192:Olfr313 UTSW 11 58817682 missense probably benign
Z1192:Olfr313 UTSW 11 58817818 missense probably benign
Predicted Primers PCR Primer

Sequencing Primer
Posted On2017-05-17