Incidental Mutation 'R0512:Rhbdf1'
ID 47923
Institutional Source Beutler Lab
Gene Symbol Rhbdf1
Ensembl Gene ENSMUSG00000020282
Gene Name rhomboid 5 homolog 1
Synonyms Dist, Dist1, Egfr-rs
MMRRC Submission 038706-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock # R0512 (G1)
Quality Score 195
Status Validated
Chromosome 11
Chromosomal Location 32209585-32222300 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 32210875 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 19 (C19*)
Ref Sequence ENSEMBL: ENSMUSP00000117471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020524] [ENSMUST00000039601] [ENSMUST00000121182] [ENSMUST00000132578] [ENSMUST00000143988] [ENSMUST00000146179] [ENSMUST00000149043] [ENSMUST00000150381]
AlphaFold Q6PIX5
Predicted Effect probably null
Transcript: ENSMUST00000020524
AA Change: C616*
SMART Domains Protein: ENSMUSP00000020524
Gene: ENSMUSG00000020282
AA Change: C616*

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Pfam:Rhomboid_SP 91 308 1.6e-116 PFAM
Pfam:Rhomboid 648 792 2.1e-32 PFAM
transmembrane domain 805 827 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000039601
SMART Domains Protein: ENSMUSP00000046654
Gene: ENSMUSG00000040767

DomainStartEndE-ValueType
PDB:1V2Y|A 31 123 4e-63 PDB
Blast:UBQ 32 119 1e-30 BLAST
SCOP:d1euvb_ 32 121 3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121182
SMART Domains Protein: ENSMUSP00000112483
Gene: ENSMUSG00000040767

DomainStartEndE-ValueType
PDB:1V2Y|A 31 83 4e-28 PDB
Blast:UBQ 32 83 2e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125837
Predicted Effect probably benign
Transcript: ENSMUST00000132578
SMART Domains Protein: ENSMUSP00000120543
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Pfam:Rhomboid_SP 91 158 7.9e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137125
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142274
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143036
Predicted Effect probably null
Transcript: ENSMUST00000143988
AA Change: C19*
SMART Domains Protein: ENSMUSP00000117471
Gene: ENSMUSG00000020282
AA Change: C19*

DomainStartEndE-ValueType
Pfam:Rhomboid 52 167 1.6e-24 PFAM
transmembrane domain 181 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146179
SMART Domains Protein: ENSMUSP00000118985
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Pfam:Rhomboid_SP 91 155 7.1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149043
SMART Domains Protein: ENSMUSP00000119306
Gene: ENSMUSG00000040767

DomainStartEndE-ValueType
PDB:1V2Y|A 31 96 1e-40 PDB
Blast:UBQ 32 96 3e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000150381
SMART Domains Protein: ENSMUSP00000118769
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155736
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 100% (92/92)
MGI Phenotype PHENOTYPE: Homozygotes for a null allele show pleiotropic phenotypes and postnatal lethality largely dependent on the genetic background. Observed defects range from small size, reduced fat mass, and brain haemorrhages to small lymph organs, thrombosis, abnormal pancreatic acini, and behavioral deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930519G04Rik T G 5: 114,863,508 M22R probably benign Het
Abca8b C A 11: 109,950,650 M1039I probably benign Het
Actn2 A T 13: 12,277,415 I653N probably damaging Het
Actr8 G T 14: 29,978,556 V31L probably benign Het
Adam30 T C 3: 98,162,125 C425R probably damaging Het
Armc1 A G 3: 19,149,495 V89A possibly damaging Het
Atr T C 9: 95,935,526 M2090T probably damaging Het
Braf T A 6: 39,664,989 probably benign Het
Cant1 A T 11: 118,411,265 N75K probably benign Het
Chd7 C T 4: 8,805,139 probably benign Het
Clec16a A G 16: 10,614,580 Y488C probably damaging Het
Col6a3 A T 1: 90,821,798 probably benign Het
Col9a2 T A 4: 121,054,307 M615K probably benign Het
D3Ertd254e T C 3: 36,166,113 C762R probably damaging Het
Dedd G A 1: 171,340,930 R228H probably damaging Het
Dhtkd1 C T 2: 5,904,091 D731N probably damaging Het
Ercc2 A G 7: 19,393,887 T651A probably damaging Het
Fam13a T A 6: 58,956,699 D302V probably damaging Het
Fam193a T C 5: 34,426,391 S19P probably damaging Het
Fam208a T C 14: 27,446,406 F302L probably damaging Het
Fam43a T C 16: 30,601,735 V379A possibly damaging Het
Fam57b C T 7: 126,827,623 R73C probably damaging Het
Fat1 C A 8: 44,951,332 Y373* probably null Het
Fbxl15 A C 19: 46,329,422 D181A probably damaging Het
Flt3 A T 5: 147,341,270 C831* probably null Het
Foxj3 T A 4: 119,585,836 probably benign Het
Glul T C 1: 153,905,386 probably benign Het
Gm16380 A T 9: 53,884,245 noncoding transcript Het
Gm7964 A T 7: 83,755,950 noncoding transcript Het
Hipk1 A G 3: 103,760,574 F559S possibly damaging Het
Hnf4g A T 3: 3,651,622 I284F probably damaging Het
Hoxa13 CCG CCGCG 6: 52,260,635 probably null Het
Icosl A G 10: 78,071,966 N120S possibly damaging Het
Ift172 A G 5: 31,285,477 V155A possibly damaging Het
Kdm4c A G 4: 74,333,794 E426G probably benign Het
Kif23 A G 9: 61,918,975 probably benign Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lama1 G A 17: 67,779,134 C1456Y possibly damaging Het
Lamc3 T A 2: 31,937,968 L1378Q probably damaging Het
Larp1b T A 3: 40,970,034 L121M probably benign Het
Lepr T A 4: 101,792,019 D872E probably damaging Het
Lepr A C 4: 101,814,704 D975A possibly damaging Het
Magi1 A G 6: 93,694,064 V1068A probably damaging Het
Malt1 T A 18: 65,458,200 N358K probably damaging Het
Mfap4 T A 11: 61,487,945 W240R probably damaging Het
Mis18a A G 16: 90,726,356 V84A possibly damaging Het
Mns1 A G 9: 72,449,471 E308G possibly damaging Het
Mpp2 C A 11: 102,062,290 L258F possibly damaging Het
Myh2 A G 11: 67,188,678 E987G probably damaging Het
Myof A G 19: 37,954,524 V702A possibly damaging Het
Nhs C A X: 161,837,359 R1467I probably damaging Het
Nrxn2 A G 19: 6,517,198 T1360A probably damaging Het
Obox6 A G 7: 15,833,949 I191T probably benign Het
Pacs2 G T 12: 113,050,927 R236L probably damaging Het
Pcdhb2 T G 18: 37,295,979 V335G probably damaging Het
Phyhipl T C 10: 70,568,918 I140M probably damaging Het
Pkhd1 T C 1: 20,310,514 probably benign Het
Ppp1r3b T G 8: 35,384,417 C137G probably damaging Het
Prdm13 T A 4: 21,678,490 I667F probably damaging Het
Prex2 A G 1: 11,199,933 M1281V probably benign Het
Rab40b A G 11: 121,359,586 F81L probably damaging Het
Rb1cc1 T C 1: 6,248,543 S729P probably damaging Het
Rcl1 A G 19: 29,128,097 D228G probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf150 G A 8: 82,864,178 V57M probably benign Het
Rp9 A G 9: 22,458,719 F51L probably benign Het
Sav1 A T 12: 69,969,201 Y274* probably null Het
Scn4a A T 11: 106,345,677 D252E probably damaging Het
Scn5a T C 9: 119,550,658 T187A probably damaging Het
Sigirr T A 7: 141,092,420 D229V probably benign Het
Slc39a13 T C 2: 91,065,686 S157G possibly damaging Het
Slc6a20a A G 9: 123,660,406 S191P probably damaging Het
Sorl1 C A 9: 42,067,832 A457S probably benign Het
Spag5 A G 11: 78,319,586 probably benign Het
Spon1 A G 7: 113,836,833 E119G possibly damaging Het
Spred2 T A 11: 20,008,485 probably benign Het
Sprr3 T G 3: 92,457,477 Q20P possibly damaging Het
Strn3 A T 12: 51,627,183 F464L possibly damaging Het
Sun1 A G 5: 139,234,847 probably benign Het
Sypl2 A G 3: 108,226,170 W28R possibly damaging Het
Syt5 A T 7: 4,542,814 V150D probably damaging Het
Thsd7a A G 6: 12,379,605 I940T possibly damaging Het
Tnrc6a T A 7: 123,186,728 probably benign Het
Trp53 T A 11: 69,588,683 L203Q probably damaging Het
Tubgcp4 T C 2: 121,175,419 V96A probably benign Het
Usp17la A G 7: 104,861,039 T284A possibly damaging Het
Usp34 T C 11: 23,451,997 M2409T probably benign Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r56 A G 7: 12,715,423 I296T probably benign Het
Vmn2r67 A G 7: 85,150,692 V446A probably damaging Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Other mutations in Rhbdf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01863:Rhbdf1 APN 11 32213484 missense probably benign
IGL02183:Rhbdf1 APN 11 32210543 missense probably damaging 1.00
IGL02793:Rhbdf1 APN 11 32213293 missense possibly damaging 0.92
IGL02875:Rhbdf1 APN 11 32213293 missense possibly damaging 0.92
BB005:Rhbdf1 UTSW 11 32209898 missense possibly damaging 0.93
BB015:Rhbdf1 UTSW 11 32209898 missense possibly damaging 0.93
FR4589:Rhbdf1 UTSW 11 32214391 unclassified probably benign
R0071:Rhbdf1 UTSW 11 32210498 missense probably damaging 1.00
R0180:Rhbdf1 UTSW 11 32210042 missense possibly damaging 0.76
R0843:Rhbdf1 UTSW 11 32215053 missense probably damaging 1.00
R0880:Rhbdf1 UTSW 11 32213432 splice site probably null
R1952:Rhbdf1 UTSW 11 32214277 nonsense probably null
R2017:Rhbdf1 UTSW 11 32210471 missense probably damaging 1.00
R2076:Rhbdf1 UTSW 11 32214088 missense probably benign 0.01
R3032:Rhbdf1 UTSW 11 32209985 missense probably damaging 1.00
R4355:Rhbdf1 UTSW 11 32216236 missense probably damaging 1.00
R4429:Rhbdf1 UTSW 11 32213369 missense probably benign 0.00
R4865:Rhbdf1 UTSW 11 32214517 missense probably damaging 1.00
R5585:Rhbdf1 UTSW 11 32210222 splice site probably null
R5728:Rhbdf1 UTSW 11 32209901 splice site probably null
R5925:Rhbdf1 UTSW 11 32212906 missense probably benign 0.24
R5940:Rhbdf1 UTSW 11 32209847 missense probably benign 0.00
R6083:Rhbdf1 UTSW 11 32210066 missense probably damaging 1.00
R6088:Rhbdf1 UTSW 11 32212007 missense possibly damaging 0.62
R6361:Rhbdf1 UTSW 11 32212915 missense possibly damaging 0.92
R6692:Rhbdf1 UTSW 11 32215652 missense probably damaging 0.98
R6727:Rhbdf1 UTSW 11 32214042 missense possibly damaging 0.78
R6825:Rhbdf1 UTSW 11 32209970 missense probably damaging 1.00
R7589:Rhbdf1 UTSW 11 32212903 missense probably benign 0.01
R7928:Rhbdf1 UTSW 11 32209898 missense possibly damaging 0.93
R7940:Rhbdf1 UTSW 11 32216258 start codon destroyed possibly damaging 0.79
R7957:Rhbdf1 UTSW 11 32210523 missense probably damaging 1.00
R8220:Rhbdf1 UTSW 11 32214563 missense probably benign 0.30
R8490:Rhbdf1 UTSW 11 32210162 missense probably damaging 0.98
R8939:Rhbdf1 UTSW 11 32210093 missense probably benign 0.00
R9040:Rhbdf1 UTSW 11 32213063 missense probably benign 0.23
R9257:Rhbdf1 UTSW 11 32210754 missense probably benign 0.00
R9509:Rhbdf1 UTSW 11 32215055 missense possibly damaging 0.96
R9575:Rhbdf1 UTSW 11 32213101 missense not run
V3553:Rhbdf1 UTSW 11 32211583 missense probably damaging 1.00
Z1176:Rhbdf1 UTSW 11 32215125 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACCACTCAGCAGGTAGATGATGGC -3'
(R):5'- GATTTCCAGCAACAGGGAGTGAGAC -3'

Sequencing Primer
(F):5'- GACCGTCATCTGGAAGCAGAC -3'
(R):5'- GACTGGGCTAGTGAAGGTG -3'
Posted On 2013-06-12