Incidental Mutation 'R8939:Rhbdf1'
ID 680858
Institutional Source Beutler Lab
Gene Symbol Rhbdf1
Ensembl Gene ENSMUSG00000020282
Gene Name rhomboid 5 homolog 1
Synonyms Dist, Dist1, Egfr-rs
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock # R8939 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 32209585-32222300 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 32210093 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 136 (A136V)
Ref Sequence ENSEMBL: ENSMUSP00000117471 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020524] [ENSMUST00000039601] [ENSMUST00000121182] [ENSMUST00000132578] [ENSMUST00000143988] [ENSMUST00000146179] [ENSMUST00000149043] [ENSMUST00000150381]
AlphaFold Q6PIX5
Predicted Effect probably benign
Transcript: ENSMUST00000020524
AA Change: A761V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000020524
Gene: ENSMUSG00000020282
AA Change: A761V

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Pfam:Rhomboid_SP 91 308 1.6e-116 PFAM
Pfam:Rhomboid 648 792 2.1e-32 PFAM
transmembrane domain 805 827 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000039601
SMART Domains Protein: ENSMUSP00000046654
Gene: ENSMUSG00000040767

DomainStartEndE-ValueType
PDB:1V2Y|A 31 123 4e-63 PDB
Blast:UBQ 32 119 1e-30 BLAST
SCOP:d1euvb_ 32 121 3e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121182
SMART Domains Protein: ENSMUSP00000112483
Gene: ENSMUSG00000040767

DomainStartEndE-ValueType
PDB:1V2Y|A 31 83 4e-28 PDB
Blast:UBQ 32 83 2e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000132578
SMART Domains Protein: ENSMUSP00000120543
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Pfam:Rhomboid_SP 91 158 7.9e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143988
AA Change: A136V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000117471
Gene: ENSMUSG00000020282
AA Change: A136V

DomainStartEndE-ValueType
Pfam:Rhomboid 52 167 1.6e-24 PFAM
transmembrane domain 181 203 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146179
SMART Domains Protein: ENSMUSP00000118985
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Pfam:Rhomboid_SP 91 155 7.1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149043
SMART Domains Protein: ENSMUSP00000119306
Gene: ENSMUSG00000040767

DomainStartEndE-ValueType
PDB:1V2Y|A 31 96 1e-40 PDB
Blast:UBQ 32 96 3e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000150381
SMART Domains Protein: ENSMUSP00000118769
Gene: ENSMUSG00000020282

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (71/71)
MGI Phenotype PHENOTYPE: Homozygotes for a null allele show pleiotropic phenotypes and postnatal lethality largely dependent on the genetic background. Observed defects range from small size, reduced fat mass, and brain haemorrhages to small lymph organs, thrombosis, abnormal pancreatic acini, and behavioral deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik C T 13: 58,385,061 A32T probably damaging Het
4930578I06Rik A G 14: 63,987,713 V12A probably benign Het
Abcc12 A G 8: 86,517,318 Y1069H probably damaging Het
Abcc9 T C 6: 142,679,251 T473A probably damaging Het
Acsm1 A T 7: 119,640,645 T271S probably benign Het
Adh6b T C 3: 138,349,636 I49T probably benign Het
Aff4 A T 11: 53,372,404 T84S probably benign Het
Angptl7 G A 4: 148,496,499 R280* probably null Het
Bhlhe23 T A 2: 180,776,306 K146N probably damaging Het
Cacna1s T C 1: 136,086,806 probably null Het
Cfap45 C G 1: 172,545,267 R510G probably damaging Het
Chl1 A G 6: 103,665,907 Y202C probably damaging Het
Chrna6 T A 8: 27,406,842 T336S probably benign Het
Clpx A G 9: 65,324,237 K535E probably benign Het
Crybg3 T C 16: 59,556,149 M1581V probably benign Het
Ddx4 A T 13: 112,622,289 I246K probably benign Het
F7 G T 8: 13,028,724 G52C probably damaging Het
Fam186b T C 15: 99,279,342 Q701R probably benign Het
Fign T A 2: 63,979,112 M605L probably benign Het
Fpr2 T C 17: 17,893,621 F293S probably damaging Het
Gm40460 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG 7: 142,240,434 probably benign Het
Gria2 A T 3: 80,710,863 probably benign Het
Grid1 G A 14: 35,321,707 D340N probably damaging Het
Gsto2 T C 19: 47,884,764 probably null Het
Hsd3b1 A G 3: 98,852,983 W231R probably damaging Het
Igflr1 CAGAG CAG 7: 30,567,463 probably null Het
Ighv1-80 C T 12: 115,912,493 G68R probably damaging Het
Il10ra A G 9: 45,266,504 V69A unknown Het
Klhdc1 C T 12: 69,253,763 A159V probably damaging Het
Krtap4-6 A G 11: 99,665,403 I166T unknown Het
Lce1h A T 3: 92,763,669 C59S unknown Het
Magi3 T C 3: 104,089,432 probably benign Het
Map3k1 G T 13: 111,756,303 S806* probably null Het
Map3k6 T A 4: 133,252,643 probably benign Het
Mgam G A 6: 40,763,203 probably null Het
Mtx1 A G 3: 89,212,726 V207A probably damaging Het
Muc5ac A T 7: 141,793,354 N356Y probably damaging Het
Myo16 T C 8: 10,474,679 F810S probably damaging Het
Nlrx1 A G 9: 44,255,464 L774P probably damaging Het
Nr1i2 C T 16: 38,266,020 V28I probably benign Het
Olfr1484 A C 19: 13,585,496 N64T probably damaging Het
Olfr63 A G 17: 33,269,615 K297R probably damaging Het
Pcmtd2 T C 2: 181,855,070 probably benign Het
Pcnx3 A G 19: 5,680,319 L102P probably damaging Het
Pnpla6 A G 8: 3,521,319 E114G possibly damaging Het
Ppp4r1 T C 17: 65,803,931 V70A probably damaging Het
Psd2 G A 18: 35,988,239 V421M probably damaging Het
Rbak C T 5: 143,174,270 E343K possibly damaging Het
Rusc1 T A 3: 89,088,030 E231D probably benign Het
Rxfp1 T C 3: 79,644,924 E690G probably damaging Het
Sdr9c7 A G 10: 127,898,907 E88G probably benign Het
Sec23b T C 2: 144,569,217 probably null Het
Sgcb A T 5: 73,644,318 I68N probably damaging Het
Sh3pxd2b T C 11: 32,414,433 probably benign Het
Slc25a48 C T 13: 56,463,706 P209S probably damaging Het
Slc9a3 C A 13: 74,163,776 H614Q possibly damaging Het
Slurp1 G A 15: 74,726,914 S76L probably damaging Het
Spen T C 4: 141,475,658 E1886G possibly damaging Het
Sqor C T 2: 122,807,629 P151S possibly damaging Het
Sstr4 C A 2: 148,396,308 L280M probably damaging Het
Stard10 A G 7: 101,342,640 Y117C probably damaging Het
Stard13 A T 5: 151,045,109 probably null Het
Stim2 G T 5: 54,105,331 R305L possibly damaging Het
Syt14 G A 1: 192,930,588 R635C probably damaging Het
Tmcc3 A T 10: 94,545,621 probably benign Het
Ttn T C 2: 76,745,351 N23320S possibly damaging Het
Ubqln4 A G 3: 88,565,716 T493A probably benign Het
Ugt2b34 A G 5: 86,891,299 L501P probably damaging Het
Umod T C 7: 119,469,477 I449V probably damaging Het
Vmn2r51 C A 7: 10,100,026 D362Y possibly damaging Het
Xirp2 A C 2: 67,516,144 T2910P probably benign Het
Zscan20 A G 4: 128,604,522 S28P probably benign Het
Other mutations in Rhbdf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01863:Rhbdf1 APN 11 32213484 missense probably benign
IGL02183:Rhbdf1 APN 11 32210543 missense probably damaging 1.00
IGL02793:Rhbdf1 APN 11 32213293 missense possibly damaging 0.92
IGL02875:Rhbdf1 APN 11 32213293 missense possibly damaging 0.92
BB005:Rhbdf1 UTSW 11 32209898 missense possibly damaging 0.93
BB015:Rhbdf1 UTSW 11 32209898 missense possibly damaging 0.93
FR4589:Rhbdf1 UTSW 11 32214391 unclassified probably benign
R0071:Rhbdf1 UTSW 11 32210498 missense probably damaging 1.00
R0180:Rhbdf1 UTSW 11 32210042 missense possibly damaging 0.76
R0512:Rhbdf1 UTSW 11 32210875 nonsense probably null
R0843:Rhbdf1 UTSW 11 32215053 missense probably damaging 1.00
R0880:Rhbdf1 UTSW 11 32213432 splice site probably null
R1952:Rhbdf1 UTSW 11 32214277 nonsense probably null
R2017:Rhbdf1 UTSW 11 32210471 missense probably damaging 1.00
R2076:Rhbdf1 UTSW 11 32214088 missense probably benign 0.01
R3032:Rhbdf1 UTSW 11 32209985 missense probably damaging 1.00
R4355:Rhbdf1 UTSW 11 32216236 missense probably damaging 1.00
R4429:Rhbdf1 UTSW 11 32213369 missense probably benign 0.00
R4865:Rhbdf1 UTSW 11 32214517 missense probably damaging 1.00
R5585:Rhbdf1 UTSW 11 32210222 splice site probably null
R5728:Rhbdf1 UTSW 11 32209901 splice site probably null
R5925:Rhbdf1 UTSW 11 32212906 missense probably benign 0.24
R5940:Rhbdf1 UTSW 11 32209847 missense probably benign 0.00
R6083:Rhbdf1 UTSW 11 32210066 missense probably damaging 1.00
R6088:Rhbdf1 UTSW 11 32212007 missense possibly damaging 0.62
R6361:Rhbdf1 UTSW 11 32212915 missense possibly damaging 0.92
R6692:Rhbdf1 UTSW 11 32215652 missense probably damaging 0.98
R6727:Rhbdf1 UTSW 11 32214042 missense possibly damaging 0.78
R6825:Rhbdf1 UTSW 11 32209970 missense probably damaging 1.00
R7589:Rhbdf1 UTSW 11 32212903 missense probably benign 0.01
R7928:Rhbdf1 UTSW 11 32209898 missense possibly damaging 0.93
R7940:Rhbdf1 UTSW 11 32216258 start codon destroyed possibly damaging 0.79
R7957:Rhbdf1 UTSW 11 32210523 missense probably damaging 1.00
R8220:Rhbdf1 UTSW 11 32214563 missense probably benign 0.30
R8490:Rhbdf1 UTSW 11 32210162 missense probably damaging 0.98
R9040:Rhbdf1 UTSW 11 32213063 missense probably benign 0.23
R9257:Rhbdf1 UTSW 11 32210754 missense probably benign 0.00
R9509:Rhbdf1 UTSW 11 32215055 missense possibly damaging 0.96
R9575:Rhbdf1 UTSW 11 32213101 missense probably benign 0.00
V3553:Rhbdf1 UTSW 11 32211583 missense probably damaging 1.00
Z1176:Rhbdf1 UTSW 11 32215125 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACTTGTCCGTGAAAGGGATGC -3'
(R):5'- GCAGCCTCAGTAGCTTAGAG -3'

Sequencing Primer
(F):5'- ATTCACAGCGCACCGGGTAG -3'
(R):5'- GCTTAGAGCTTCCAACCCC -3'
Posted On 2021-08-31