Incidental Mutation 'R6050:Psg25'
ID483500
Institutional Source Beutler Lab
Gene Symbol Psg25
Ensembl Gene ENSMUSG00000070798
Gene Namepregnancy-specific glycoprotein 25
Synonymscea13
MMRRC Submission 044218-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R6050 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location18519702-18532269 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18526478 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 165 (V165A)
Ref Sequence ENSEMBL: ENSMUSP00000092389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094795]
Predicted Effect probably benign
Transcript: ENSMUST00000094795
AA Change: V165A

PolyPhen 2 Score 0.373 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000092389
Gene: ENSMUSG00000070798
AA Change: V165A

DomainStartEndE-ValueType
IG 40 141 2.15e-3 SMART
IG 160 261 1.55e0 SMART
IG 280 381 3.59e-5 SMART
IGc2 397 461 1.02e-9 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b C A 11: 109,977,813 G175V probably damaging Het
Ahdc1 A G 4: 133,065,891 D1481G possibly damaging Het
Ak9 A G 10: 41,389,112 E955G possibly damaging Het
Aox3 T C 1: 58,180,655 F1138S possibly damaging Het
Bbs2 T A 8: 94,092,532 N70Y probably damaging Het
BC048679 T C 7: 81,495,591 I70V possibly damaging Het
Ccdc141 G T 2: 77,011,731 A1452E probably benign Het
Celsr1 T C 15: 85,930,611 D1883G probably benign Het
Clhc1 A G 11: 29,561,397 I280M possibly damaging Het
Cmtr1 G T 17: 29,682,134 K678N probably damaging Het
Daam2 T C 17: 49,486,502 D329G possibly damaging Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Duox1 C T 2: 122,319,475 P116S probably benign Het
Fcf1 G A 12: 84,982,243 C154Y probably damaging Het
Frem2 T C 3: 53,653,012 N1358S probably damaging Het
Gm16432 G A 1: 178,103,924 A470T unknown Het
Gtf2h3 C T 5: 124,584,297 T121I probably benign Het
Gtf3c3 T C 1: 54,406,070 I608M probably benign Het
Gzf1 G A 2: 148,684,238 D210N possibly damaging Het
Ift140 C T 17: 25,091,005 R1129C probably damaging Het
Lias A G 5: 65,393,972 I83V possibly damaging Het
Mgea5 A C 19: 45,765,480 S652A possibly damaging Het
Mlh3 T C 12: 85,240,846 T1342A possibly damaging Het
Mn1 A G 5: 111,419,397 Y411C probably damaging Het
Mrps21 C T 3: 95,862,888 R43H probably benign Het
Ncam2 C T 16: 81,443,166 Q172* probably null Het
Notch3 T C 17: 32,143,527 T1375A probably benign Het
Ovol3 T A 7: 30,234,394 Y101F probably benign Het
Pcbp4 T C 9: 106,462,223 V45A probably benign Het
Plec T C 15: 76,188,258 E709G probably damaging Het
Prcc G A 3: 87,869,884 T261I probably damaging Het
Rfk C T 19: 17,399,532 P133S probably benign Het
Scaf8 C T 17: 3,168,108 T251M unknown Het
Sec14l2 T C 11: 4,111,477 D67G probably benign Het
Smtnl1 A G 2: 84,811,453 I441T probably damaging Het
Tbce C T 13: 13,998,434 V471I possibly damaging Het
Tnip1 G A 11: 54,917,877 R495C probably damaging Het
Trbv19 A G 6: 41,179,010 K105R probably benign Het
Ttc5 T A 14: 50,773,287 N229I probably damaging Het
Ush2a T C 1: 188,957,324 F5028L probably benign Het
Vmn2r24 T C 6: 123,815,732 S673P probably damaging Het
Zfp780b A T 7: 27,964,302 I276N probably damaging Het
Other mutations in Psg25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Psg25 APN 7 18526181 splice site probably benign
IGL00508:Psg25 APN 7 18529731 missense probably benign
IGL01154:Psg25 APN 7 18524699 missense probably benign 0.01
IGL01388:Psg25 APN 7 18529665 missense possibly damaging 0.87
IGL02222:Psg25 APN 7 18529727 missense probably damaging 1.00
IGL02261:Psg25 APN 7 18521343 missense probably benign 0.09
IGL02309:Psg25 APN 7 18526424 missense probably damaging 0.98
IGL02803:Psg25 APN 7 18526287 missense possibly damaging 0.47
IGL03334:Psg25 APN 7 18529774 missense probably benign 0.01
R0711:Psg25 UTSW 7 18529560 nonsense probably null
R1458:Psg25 UTSW 7 18529587 missense probably damaging 1.00
R1598:Psg25 UTSW 7 18532003 nonsense probably null
R2064:Psg25 UTSW 7 18521253 missense probably damaging 0.96
R2066:Psg25 UTSW 7 18529562 missense probably damaging 1.00
R4485:Psg25 UTSW 7 18526278 missense probably damaging 1.00
R4499:Psg25 UTSW 7 18524891 missense possibly damaging 0.89
R4514:Psg25 UTSW 7 18529608 nonsense probably null
R4547:Psg25 UTSW 7 18524704 missense probably damaging 1.00
R4604:Psg25 UTSW 7 18529803 missense probably benign 0.05
R4886:Psg25 UTSW 7 18524913 missense probably benign 0.00
R5121:Psg25 UTSW 7 18526536 missense possibly damaging 0.68
R5208:Psg25 UTSW 7 18526535 missense probably benign 0.00
R5267:Psg25 UTSW 7 18524786 missense possibly damaging 0.78
R5376:Psg25 UTSW 7 18526535 missense probably benign 0.00
R5425:Psg25 UTSW 7 18524784 nonsense probably null
R5749:Psg25 UTSW 7 18524851 missense probably damaging 1.00
R6862:Psg25 UTSW 7 18521398 missense probably benign 0.03
R6962:Psg25 UTSW 7 18529754 missense probably damaging 1.00
R7238:Psg25 UTSW 7 18532202 start gained probably benign
R7782:Psg25 UTSW 7 18521302 missense probably benign 0.15
R7812:Psg25 UTSW 7 18521168 missense possibly damaging 0.71
R8155:Psg25 UTSW 7 18526520 missense probably benign 0.00
Z1088:Psg25 UTSW 7 18529591 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGAAGCAGCAGGGATCCATTG -3'
(R):5'- ACTCCACCAAGTATAGCAGGGAG -3'

Sequencing Primer
(F):5'- AGGGATCCATTGCTGTACAC -3'
(R):5'- GGGAGACCCTCACCCAC -3'
Posted On2017-07-14