Incidental Mutation 'R6109:Slf1'
ID484738
Institutional Source Beutler Lab
Gene Symbol Slf1
Ensembl Gene ENSMUSG00000021597
Gene NameSMC5-SMC6 complex localization factor 1
Synonyms2700017A04Rik, Brctx, Brctd1, C730024G01Rik, Ankrd32
MMRRC Submission 044259-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6109 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location77043088-77135473 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 77126680 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 12 (M12K)
Ref Sequence ENSEMBL: ENSMUSP00000124865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000151524] [ENSMUST00000159300] [ENSMUST00000159462] [ENSMUST00000162921] [ENSMUST00000162944]
Predicted Effect probably damaging
Transcript: ENSMUST00000151524
AA Change: M12K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118312
Gene: ENSMUSG00000021597
AA Change: M12K

DomainStartEndE-ValueType
BRCT 2 80 1.37e-2 SMART
BRCT 121 199 2.12e1 SMART
low complexity region 260 273 N/A INTRINSIC
low complexity region 527 541 N/A INTRINSIC
low complexity region 765 785 N/A INTRINSIC
ANK 802 832 1.52e0 SMART
ANK 836 865 4.32e-5 SMART
ANK 870 900 2.07e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159300
AA Change: M12K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124865
Gene: ENSMUSG00000021597
AA Change: M12K

DomainStartEndE-ValueType
BRCT 2 80 1.37e-2 SMART
BRCT 121 199 2.12e1 SMART
low complexity region 260 273 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159462
AA Change: M18K

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124543
Gene: ENSMUSG00000021597
AA Change: M18K

DomainStartEndE-ValueType
BRCT 8 86 1.37e-2 SMART
BRCT 127 205 2.12e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162320
Predicted Effect possibly damaging
Transcript: ENSMUST00000162921
AA Change: M12K

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124946
Gene: ENSMUSG00000021597
AA Change: M12K

DomainStartEndE-ValueType
BRCT 2 80 1.37e-2 SMART
Blast:BRCT 121 173 1e-8 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000162944
AA Change: M12K

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000123982
Gene: ENSMUSG00000021597
AA Change: M12K

DomainStartEndE-ValueType
BRCT 2 80 1.37e-2 SMART
Blast:BRCT 121 173 1e-8 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 100% (64/64)
MGI Phenotype PHENOTYPE: Homozygous null mice are developmentally normal and fertile with no pathological abnormalities or defects in T-cell development and genomic stability. Mutant MEFs grow at a normal rate and are not more sensitive to DNA-damaging agents while thymocytes donot show any major cell cycle defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T C 19: 11,101,912 M131V possibly damaging Het
Abcc10 T C 17: 46,310,377 Y950C probably benign Het
Acadm A G 3: 153,941,943 C20R probably damaging Het
Agtpbp1 G T 13: 59,473,746 T984K probably damaging Het
Agxt2 C T 15: 10,377,422 T136I probably damaging Het
Ankrd36 C A 11: 5,628,941 N68K probably damaging Het
Ap3b2 T A 7: 81,493,592 D10V possibly damaging Het
Apcdd1 A T 18: 62,937,366 I235F probably damaging Het
Arhgap32 T A 9: 32,260,111 W1396R probably damaging Het
Ascc3 A G 10: 50,649,247 T513A probably benign Het
Aym1 C T 5: 113,357,541 L9F unknown Het
Btnl10 C A 11: 58,920,304 S151Y probably damaging Het
Camk2a A T 18: 60,943,234 K95* probably null Het
Ccdc40 T C 11: 119,231,978 V202A probably benign Het
Cd200r3 T A 16: 44,953,682 D152E probably benign Het
Cd2bp2 C T 7: 127,194,815 D101N probably damaging Het
Cdh20 G A 1: 104,994,014 D679N probably damaging Het
Clpx C T 9: 65,299,952 T44I probably benign Het
Cnnm4 T G 1: 36,498,479 V541G probably damaging Het
Csmd1 T C 8: 16,199,860 I1035V possibly damaging Het
Ctsw T C 19: 5,467,119 S62G probably benign Het
Dlk2 T A 17: 46,301,697 Y109N probably damaging Het
Ebf3 C T 7: 137,206,226 V363M probably damaging Het
Farsb A G 1: 78,463,270 probably null Het
Fastkd3 C T 13: 68,590,218 Q32* probably null Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gk5 C A 9: 96,140,610 F166L probably benign Het
Gm11271 G T 13: 21,381,139 noncoding transcript Het
Gm5294 C A 5: 138,820,095 Q6K probably damaging Het
Gnat2 T A 3: 108,100,135 Y290N probably damaging Het
H2-D1 A T 17: 35,263,937 I148F probably damaging Het
Hdac2 A G 10: 36,986,389 D83G probably null Het
Kdm5d T C Y: 921,501 W500R probably damaging Het
Kel A T 6: 41,688,862 F489I probably benign Het
Kmo C A 1: 175,637,908 A76E possibly damaging Het
Krt32 T C 11: 100,087,965 T88A probably benign Het
Lce3b A G 3: 92,933,687 T30A unknown Het
Lcn11 A G 2: 25,779,296 H155R possibly damaging Het
Lmln T A 16: 33,069,111 I129N possibly damaging Het
Meiob A G 17: 24,813,019 K3E probably benign Het
Mitf C T 6: 97,996,468 T229M probably damaging Het
Muc16 T C 9: 18,655,359 I1955V unknown Het
Naip1 A G 13: 100,427,182 C492R probably damaging Het
Ncor2 C T 5: 125,055,846 A26T probably damaging Het
Ngfr T G 11: 95,578,057 D165A probably damaging Het
Nobox A T 6: 43,305,169 S323R probably damaging Het
Olfr616 T C 7: 103,565,139 I47V probably benign Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Olfr937 A G 9: 39,060,196 S157P probably benign Het
Pcdhb1 G T 18: 37,265,253 V86F possibly damaging Het
Pdk1 A G 2: 71,883,506 E165G probably benign Het
Peak1 C T 9: 56,259,283 V454I probably benign Het
Rad9b C T 5: 122,344,297 G125D probably damaging Het
S100a16 T C 3: 90,542,074 F19L probably damaging Het
Serpine2 T C 1: 79,810,671 K190E probably damaging Het
Tex101 T C 7: 24,668,313 T205A possibly damaging Het
Tssk5 T C 15: 76,373,716 E147G probably damaging Het
Ubr4 A G 4: 139,417,364 T1495A probably damaging Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Wdr70 A T 15: 8,079,154 probably null Het
Zfp811 T A 17: 32,797,374 probably null Het
Zscan10 T A 17: 23,607,129 F88L probably damaging Het
Other mutations in Slf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Slf1 APN 13 77043947 missense possibly damaging 0.95
IGL01105:Slf1 APN 13 77100912 unclassified probably benign
IGL01108:Slf1 APN 13 77125475 splice site probably benign
IGL01149:Slf1 APN 13 77112648 missense probably damaging 0.99
IGL01642:Slf1 APN 13 77049915 missense probably benign 0.00
IGL01757:Slf1 APN 13 77084440 missense probably benign
IGL01887:Slf1 APN 13 77100982 missense probably benign 0.02
IGL02323:Slf1 APN 13 77051294 missense possibly damaging 0.87
IGL02861:Slf1 APN 13 77126359 splice site probably benign
IGL02971:Slf1 APN 13 77047104 splice site probably benign
IGL03088:Slf1 APN 13 77084435 missense probably damaging 1.00
IGL03215:Slf1 APN 13 77049977 missense probably benign 0.00
IGL02980:Slf1 UTSW 13 77044004 missense possibly damaging 0.92
PIT1430001:Slf1 UTSW 13 77050050 splice site probably benign
R0036:Slf1 UTSW 13 77100951 missense probably benign 0.02
R0036:Slf1 UTSW 13 77100951 missense probably benign 0.02
R0125:Slf1 UTSW 13 77043745 missense probably benign 0.02
R0230:Slf1 UTSW 13 77112748 intron probably benign
R0244:Slf1 UTSW 13 77126632 nonsense probably null
R0395:Slf1 UTSW 13 77105969 splice site probably benign
R0614:Slf1 UTSW 13 77049114 missense probably benign 0.10
R0661:Slf1 UTSW 13 77083596 missense probably benign 0.31
R0837:Slf1 UTSW 13 77100948 splice site probably null
R0945:Slf1 UTSW 13 77103471 unclassified probably benign
R1282:Slf1 UTSW 13 77043840 missense probably damaging 0.97
R1365:Slf1 UTSW 13 77126371 missense probably damaging 1.00
R1449:Slf1 UTSW 13 77083449 missense probably damaging 1.00
R1646:Slf1 UTSW 13 77066648 nonsense probably null
R2071:Slf1 UTSW 13 77104624 missense probably benign 0.02
R2141:Slf1 UTSW 13 77049219 critical splice acceptor site probably null
R2217:Slf1 UTSW 13 77046706 critical splice acceptor site probably null
R2397:Slf1 UTSW 13 77103583 nonsense probably null
R2520:Slf1 UTSW 13 77051265 missense probably damaging 1.00
R3108:Slf1 UTSW 13 77126721 splice site probably benign
R4178:Slf1 UTSW 13 77043569 missense probably damaging 1.00
R4663:Slf1 UTSW 13 77126604 missense probably damaging 1.00
R4730:Slf1 UTSW 13 77046632 missense probably damaging 1.00
R4910:Slf1 UTSW 13 77043880 missense probably benign 0.14
R4912:Slf1 UTSW 13 77051294 missense probably damaging 1.00
R5122:Slf1 UTSW 13 77049987 missense probably benign 0.01
R5269:Slf1 UTSW 13 77104581 missense probably benign 0.33
R5336:Slf1 UTSW 13 77106010 makesense probably null
R5346:Slf1 UTSW 13 77092371 missense probably benign 0.00
R5445:Slf1 UTSW 13 77091204 missense probably benign 0.10
R5568:Slf1 UTSW 13 77046704 missense probably damaging 1.00
R5622:Slf1 UTSW 13 77049971 missense probably benign 0.14
R5685:Slf1 UTSW 13 77083479 missense possibly damaging 0.88
R5792:Slf1 UTSW 13 77066737 missense probably benign 0.03
R5856:Slf1 UTSW 13 77106087 missense possibly damaging 0.63
R6245:Slf1 UTSW 13 77084383 missense probably damaging 1.00
R6338:Slf1 UTSW 13 77084462 critical splice acceptor site probably null
R6438:Slf1 UTSW 13 77066606 missense probably damaging 1.00
R6487:Slf1 UTSW 13 77066617 missense probably damaging 1.00
R6597:Slf1 UTSW 13 77049129 missense probably benign 0.01
R6600:Slf1 UTSW 13 77083536 missense probably benign 0.00
R6661:Slf1 UTSW 13 77043845 missense probably damaging 1.00
R7268:Slf1 UTSW 13 77066707 missense probably damaging 1.00
R7308:Slf1 UTSW 13 77051168 missense probably benign 0.19
R7355:Slf1 UTSW 13 77091303 missense probably damaging 1.00
R7546:Slf1 UTSW 13 77049192 missense probably benign
R7807:Slf1 UTSW 13 77046704 missense probably damaging 1.00
R8175:Slf1 UTSW 13 77112671 missense probably damaging 1.00
R8385:Slf1 UTSW 13 77105990 missense probably benign
R8698:Slf1 UTSW 13 77049165 missense possibly damaging 0.78
R8770:Slf1 UTSW 13 77046647 missense probably damaging 1.00
R8786:Slf1 UTSW 13 77126687 missense possibly damaging 0.93
R8796:Slf1 UTSW 13 77066665 missense probably benign 0.00
X0018:Slf1 UTSW 13 77051238 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTCGTTCAGCTATAAGATGTG -3'
(R):5'- ATAATACTGGAGGGTTTCAATGGTG -3'

Sequencing Primer
(F):5'- GTCGTTCAGCTATAAGATGTGTACAG -3'
(R):5'- CGTTGTTTACAAGTAAGCTTAACATG -3'
Posted On2017-08-16