Mutagenetix > Incidental Mutation

Incidental Mutation 'R0837:Slf1'

78011

Institutional Source

Beutler Lab

Gene Symbol

Slf1

Ensembl Gene

ENSMUSG00000021597

Gene Name

SMC5-SMC6 complex localization factor 1

Synonyms

2700017A04Rik, Brctx, Brctd1, C730024G01Rik, Ankrd32

MMRRC Submission

039016-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0837 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

77043088-77135473 bp(-) (GRCm38)

Type of Mutation

splice site (3672 bp from exon)

DNA Base Change (assembly)

T to C at 77100948 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000124543 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000151524] [ENSMUST00000159300] [ENSMUST00000159462] [ENSMUST00000162921] [ENSMUST00000162944]

AlphaFold

Q8R3P9

Predicted Effect

probably benign
Transcript: ENSMUST00000151524
AA Change: I374V

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000118312
Gene: ENSMUSG00000021597
AA Change: I374V

Domain	Start	End	E-Value	Type
BRCT	2	80	1.37e-2	SMART
BRCT	121	199	2.12e1	SMART
low complexity region	260	273	N/A	INTRINSIC
low complexity region	527	541	N/A	INTRINSIC
low complexity region	765	785	N/A	INTRINSIC
ANK	802	832	1.52e0	SMART
ANK	836	865	4.32e-5	SMART
ANK	870	900	2.07e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000159300

SMART Domains

Protein: ENSMUSP00000124865
Gene: ENSMUSG00000021597

Domain	Start	End	E-Value	Type
BRCT	2	80	1.37e-2	SMART
BRCT	121	199	2.12e1	SMART
low complexity region	260	273	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000159462

SMART Domains

Protein: ENSMUSP00000124543
Gene: ENSMUSG00000021597

Domain	Start	End	E-Value	Type
BRCT	8	86	1.37e-2	SMART
BRCT	127	205	2.12e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162320

Predicted Effect

probably benign
Transcript: ENSMUST00000162921

SMART Domains

Protein: ENSMUSP00000124946
Gene: ENSMUSG00000021597

Domain	Start	End	E-Value	Type
BRCT	2	80	1.37e-2	SMART
Blast:BRCT	121	173	1e-8	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000162944

SMART Domains

Protein: ENSMUSP00000123982
Gene: ENSMUSG00000021597

Domain	Start	End	E-Value	Type
BRCT	2	80	1.37e-2	SMART
Blast:BRCT	121	173	1e-8	BLAST

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.4%
20x: 94.8%

Validation Efficiency

96% (44/46)

MGI Phenotype

PHENOTYPE: Homozygous null mice are developmentally normal and fertile with no pathological abnormalities or defects in T-cell development and genomic stability. Mutant MEFs grow at a normal rate and are not more sensitive to DNA-damaging agents while thymocytes donot show any major cell cycle defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930563I02Rik	T	C	14: 60,095,926		probably benign	Het
4930579C12Rik	A	G	9: 89,168,207		noncoding transcript	Het
Adam34	T	A	8: 43,651,500	K369N	probably benign	Het
Ap1g1	T	C	8: 109,851,065	W481R	probably damaging	Het
Bicdl1	G	A	5: 115,731,292	P26S	probably benign	Het
Cacna1c	A	T	6: 118,630,270	C1224*	probably null	Het
Cpsf2	C	T	12: 101,997,242		probably benign	Het
Cyp11b2	G	A	15: 74,853,641	R210W	probably damaging	Het
Dock7	C	T	4: 98,989,258	V1048I	probably benign	Het
Dync2h1	C	A	9: 7,077,979	A2908S	probably benign	Het
Elane	A	G	10: 79,887,108	D116G	probably damaging	Het
Epb41l2	C	T	10: 25,507,816	R153C	probably damaging	Het
Gucy2c	G	A	6: 136,722,420	P617L	probably damaging	Het
Hist2h2ab	G	A	3: 96,220,123	A70T	probably damaging	Het
Kcnq4	T	A	4: 120,746,861	I106L	probably benign	Het
Man2b1	A	G	8: 85,096,829	N931D	possibly damaging	Het
Mthfs	A	G	9: 89,215,390	E100G	probably damaging	Het
Mto1	A	T	9: 78,473,790	I639F	probably damaging	Het
Myo15	A	G	11: 60,487,251	E177G	probably damaging	Het
Naip5	T	A	13: 100,230,743	M282L	probably benign	Het
Olfr433	A	G	1: 174,042,487	D179G	probably damaging	Het
Pik3c2g	G	A	6: 139,957,699		probably benign	Het
Prl7d1	T	A	13: 27,714,338	M64L	probably benign	Het
Prnp	A	T	2: 131,936,524	N32I	probably damaging	Het
Ptpn11	C	T	5: 121,149,111	V406I	probably benign	Het
Rab40c	G	A	17: 25,884,693	T151I	probably damaging	Het
Rb1cc1	T	A	1: 6,234,271		probably null	Het
Rnf145	T	C	11: 44,524,988	V10A	probably benign	Het
Rtn4rl2	T	C	2: 84,880,692	N70S	probably damaging	Het
Scaper	A	T	9: 55,859,042	C483*	probably null	Het
Sema4a	T	A	3: 88,453,098	Q58L	possibly damaging	Het
Sycp1	G	T	3: 102,915,245	N364K	probably benign	Het
Tenm4	T	C	7: 96,896,275		probably benign	Het
Tnfaip2	A	G	12: 111,450,707	T537A	probably damaging	Het
Trappc12	A	G	12: 28,703,597	I573T	possibly damaging	Het
Ugt2b38	G	A	5: 87,411,773	T420I	probably damaging	Het
Ulk1	A	T	5: 110,789,545		probably benign	Het
Unc80	G	A	1: 66,648,944	C2367Y	possibly damaging	Het
Usp7	C	A	16: 8,703,502	G135C	probably damaging	Het
Vmn2r103	A	G	17: 19,793,927	Y327C	probably damaging	Het
Vmn2r28	T	A	7: 5,488,027	H407L	probably damaging	Het
Zfp804a	A	C	2: 82,259,162	T1112P	probably damaging	Het
Zfr2	A	G	10: 81,245,408	K431E	probably damaging	Het
Zfy1	A	T	Y: 725,850	Y638*	probably null	Het

Other mutations in Slf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00942:Slf1	APN	13	77043947	missense	possibly damaging	0.95
IGL01105:Slf1	APN	13	77100912	unclassified	probably benign
IGL01108:Slf1	APN	13	77125475	splice site	probably benign
IGL01149:Slf1	APN	13	77112648	missense	probably damaging	0.99
IGL01642:Slf1	APN	13	77049915	missense	probably benign	0.00
IGL01757:Slf1	APN	13	77084440	missense	probably benign
IGL01887:Slf1	APN	13	77100982	missense	probably benign	0.02
IGL02323:Slf1	APN	13	77051294	missense	possibly damaging	0.87
IGL02861:Slf1	APN	13	77126359	splice site	probably benign
IGL02971:Slf1	APN	13	77047104	splice site	probably benign
IGL03088:Slf1	APN	13	77084435	missense	probably damaging	1.00
IGL03215:Slf1	APN	13	77049977	missense	probably benign	0.00
IGL02980:Slf1	UTSW	13	77044004	missense	possibly damaging	0.92
PIT1430001:Slf1	UTSW	13	77050050	splice site	probably benign
R0036:Slf1	UTSW	13	77100951	missense	probably benign	0.02
R0036:Slf1	UTSW	13	77100951	missense	probably benign	0.02
R0125:Slf1	UTSW	13	77043745	missense	probably benign	0.02
R0230:Slf1	UTSW	13	77112748	intron	probably benign
R0244:Slf1	UTSW	13	77126632	nonsense	probably null
R0395:Slf1	UTSW	13	77105969	splice site	probably benign
R0614:Slf1	UTSW	13	77049114	missense	probably benign	0.10
R0661:Slf1	UTSW	13	77083596	missense	probably benign	0.31
R0945:Slf1	UTSW	13	77103471	unclassified	probably benign
R1282:Slf1	UTSW	13	77043840	missense	probably damaging	0.97
R1365:Slf1	UTSW	13	77126371	missense	probably damaging	1.00
R1449:Slf1	UTSW	13	77083449	missense	probably damaging	1.00
R1646:Slf1	UTSW	13	77066648	nonsense	probably null
R2071:Slf1	UTSW	13	77104624	missense	probably benign	0.02
R2141:Slf1	UTSW	13	77049219	critical splice acceptor site	probably null
R2217:Slf1	UTSW	13	77046706	critical splice acceptor site	probably null
R2397:Slf1	UTSW	13	77103583	nonsense	probably null
R2520:Slf1	UTSW	13	77051265	missense	probably damaging	1.00
R3108:Slf1	UTSW	13	77126721	splice site	probably benign
R4178:Slf1	UTSW	13	77043569	missense	probably damaging	1.00
R4663:Slf1	UTSW	13	77126604	missense	probably damaging	1.00
R4730:Slf1	UTSW	13	77046632	missense	probably damaging	1.00
R4910:Slf1	UTSW	13	77043880	missense	probably benign	0.14
R4912:Slf1	UTSW	13	77051294	missense	probably damaging	1.00
R5122:Slf1	UTSW	13	77049987	missense	probably benign	0.01
R5269:Slf1	UTSW	13	77104581	missense	probably benign	0.33
R5336:Slf1	UTSW	13	77106010	makesense	probably null
R5346:Slf1	UTSW	13	77092371	missense	probably benign	0.00
R5445:Slf1	UTSW	13	77091204	missense	probably benign	0.10
R5568:Slf1	UTSW	13	77046704	missense	probably damaging	1.00
R5622:Slf1	UTSW	13	77049971	missense	probably benign	0.14
R5685:Slf1	UTSW	13	77083479	missense	possibly damaging	0.88
R5792:Slf1	UTSW	13	77066737	missense	probably benign	0.03
R5856:Slf1	UTSW	13	77106087	missense	possibly damaging	0.63
R6109:Slf1	UTSW	13	77126680	missense	probably damaging	0.99
R6245:Slf1	UTSW	13	77084383	missense	probably damaging	1.00
R6338:Slf1	UTSW	13	77084462	critical splice acceptor site	probably null
R6438:Slf1	UTSW	13	77066606	missense	probably damaging	1.00
R6487:Slf1	UTSW	13	77066617	missense	probably damaging	1.00
R6597:Slf1	UTSW	13	77049129	missense	probably benign	0.01
R6600:Slf1	UTSW	13	77083536	missense	probably benign	0.00
R6661:Slf1	UTSW	13	77043845	missense	probably damaging	1.00
R7268:Slf1	UTSW	13	77066707	missense	probably damaging	1.00
R7308:Slf1	UTSW	13	77051168	missense	probably benign	0.19
R7355:Slf1	UTSW	13	77091303	missense	probably damaging	1.00
R7546:Slf1	UTSW	13	77049192	missense	probably benign
R7807:Slf1	UTSW	13	77046704	missense	probably damaging	1.00
R8175:Slf1	UTSW	13	77112671	missense	probably damaging	1.00
R8385:Slf1	UTSW	13	77105990	missense	probably benign
R8698:Slf1	UTSW	13	77049165	missense	possibly damaging	0.78
R8770:Slf1	UTSW	13	77046647	missense	probably damaging	1.00
R8786:Slf1	UTSW	13	77126687	missense	possibly damaging	0.93
R8796:Slf1	UTSW	13	77066665	missense	probably benign	0.00
R8932:Slf1	UTSW	13	77046574	missense	probably damaging	1.00
R9132:Slf1	UTSW	13	77100954	missense	probably benign	0.24
R9243:Slf1	UTSW	13	77125456	missense	possibly damaging	0.95
R9274:Slf1	UTSW	13	77043550	makesense	probably null
R9286:Slf1	UTSW	13	77043813	missense	probably damaging	0.99
R9416:Slf1	UTSW	13	77046537	missense
X0018:Slf1	UTSW	13	77051238	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGAGATGCAAAGGGTCTAATGCAAC -3'
(R):5'- ATTTAGCTCAGGGGTCTAGCCCTCAG -3'

Sequencing Primer
(F):5'- GGTCTAATGCAACAAACTAGATCG -3'
(R):5'- GGGTCCTGTGATCAAAAACAATC -3'

Posted On

2013-10-16