Mutagenetix > Incidental Mutation

Incidental Mutation 'R5445:Slf1'

427424

Institutional Source

Beutler Lab

Gene Symbol

Slf1

Ensembl Gene

ENSMUSG00000021597

Gene Name

SMC5-SMC6 complex localization factor 1

Synonyms

2700017A04Rik, Brctx, Brctd1, C730024G01Rik, Ankrd32

MMRRC Submission

043010-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5445 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

77043088-77135473 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 77091204 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 447 (I447N)

Ref Sequence

ENSEMBL: ENSMUSP00000118312 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000151524]

AlphaFold

Q8R3P9

Predicted Effect

probably benign
Transcript: ENSMUST00000151524
AA Change: I447N

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000118312
Gene: ENSMUSG00000021597
AA Change: I447N

Domain	Start	End	E-Value	Type
BRCT	2	80	1.37e-2	SMART
BRCT	121	199	2.12e1	SMART
low complexity region	260	273	N/A	INTRINSIC
low complexity region	527	541	N/A	INTRINSIC
low complexity region	765	785	N/A	INTRINSIC
ANK	802	832	1.52e0	SMART
ANK	836	865	4.32e-5	SMART
ANK	870	900	2.07e-2	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mice are developmentally normal and fertile with no pathological abnormalities or defects in T-cell development and genomic stability. Mutant MEFs grow at a normal rate and are not more sensitive to DNA-damaging agents while thymocytes donot show any major cell cycle defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430105I19Rik	T	C	2: 118,759,586	D259G	probably damaging	Het
Abcg5	A	T	17: 84,671,129	D300E	probably damaging	Het
Apbb1ip	T	C	2: 22,835,948	V244A	possibly damaging	Het
Arhgap32	T	C	9: 32,248,382	S232P	probably benign	Het
Atf7ip	G	A	6: 136,587,257	V833M	probably damaging	Het
Casp7	A	G	19: 56,433,338		probably null	Het
Celsr2	T	A	3: 108,392,658	E2911D	probably benign	Het
Cep350	T	C	1: 155,894,723	D1807G	probably benign	Het
Chrd	A	G	16: 20,738,910	T753A	possibly damaging	Het
Clasp2	A	G	9: 113,903,946	D971G	probably damaging	Het
Cnnm2	A	G	19: 46,877,288	T772A	possibly damaging	Het
Cntn1	A	T	15: 92,295,077	N687Y	probably damaging	Het
Col6a3	G	A	1: 90,782,039	R1812*	probably null	Het
Dsc2	T	C	18: 20,035,303	I700V	possibly damaging	Het
Fam71d	G	A	12: 78,715,116	E185K	probably damaging	Het
Flt3	G	A	5: 147,355,095	Q540*	probably null	Het
Fmo4	T	A	1: 162,805,273	I170F	probably benign	Het
Fra10ac1	T	A	19: 38,219,462	D72V	possibly damaging	Het
Gemin6	T	G	17: 80,227,749	V46G	probably damaging	Het
Gm13023	T	A	4: 143,795,137	V441E	possibly damaging	Het
Gm2381	T	G	7: 42,820,001	H233P	probably damaging	Het
Gm5148	T	A	3: 37,714,846	Q75L	probably damaging	Het
Gm8369	T	C	19: 11,504,806	V27A	possibly damaging	Het
Gpr157	T	C	4: 150,102,368	S318P	probably benign	Het
Hectd4	G	A	5: 121,266,274	V405M	probably benign	Het
Hemgn	T	C	4: 46,400,738	R41G	probably benign	Het
Hhipl1	T	A	12: 108,328,208	L791Q	probably damaging	Het
Hjurp	T	G	1: 88,266,316	K290T	probably benign	Het
Ifi207	T	C	1: 173,727,797	E773G	probably damaging	Het
Kcnh6	T	C	11: 106,023,859	Y697H	probably damaging	Het
Lonrf2	T	C	1: 38,807,153	T313A	probably benign	Het
Lrba	G	T	3: 86,368,595	V1757L	probably benign	Het
Lrrc24	T	C	15: 76,716,106	T278A	probably benign	Het
Ltbp2	T	C	12: 84,809,654	I679V	probably null	Het
Mapk4	G	T	18: 73,931,002	T383K	probably benign	Het
Mdn1	C	T	4: 32,723,690	P2542L	probably damaging	Het
Mia3	A	G	1: 183,336,022	V208A	probably benign	Het
Myo15	C	A	11: 60,520,777	C3234*	probably null	Het
Nlrp1b	G	T	11: 71,217,875	Q267K	probably benign	Het
Nphp3	A	G	9: 104,004,723	K37E	probably damaging	Het
Nwd2	T	C	5: 63,805,338	M755T	probably damaging	Het
Olfr482	A	G	7: 108,094,742	V276A	possibly damaging	Het
Olfr655	A	G	7: 104,596,821	F120S	probably damaging	Het
Olfr819	T	A	10: 129,966,289	H137L	probably benign	Het
Pdlim5	C	T	3: 142,352,734	R83K	probably null	Het
Plekha5	A	T	6: 140,552,733	R173*	probably null	Het
Rbms3	T	A	9: 117,251,785	D6V	possibly damaging	Het
Rhoq	A	T	17: 86,964,327	Y57F	probably benign	Het
Rrm1	A	T	7: 102,451,023	T204S	possibly damaging	Het
Smarcc2	T	A	10: 128,488,074		probably benign	Het
Spdye4c	C	T	2: 128,596,564	Q281*	probably null	Het
Tert	T	A	13: 73,644,284	M890K	probably benign	Het
Tln1	C	A	4: 43,543,905	R1198L	probably benign	Het
Tmco4	A	G	4: 139,020,867	M253V	probably damaging	Het
Usp19	G	T	9: 108,497,920	V782F	possibly damaging	Het
Usp33	T	A	3: 152,374,623	S464T	probably damaging	Het
Usp47	A	T	7: 112,074,721	Y397F	probably damaging	Het
Vmn1r12	A	G	6: 57,159,481	T144A	probably benign	Het
Vmn2r90	A	T	17: 17,734,124	H850L	probably benign	Het
Wdr66	C	T	5: 123,287,177	T294M	probably damaging	Het
Zfhx3	A	T	8: 108,956,210	Q3427L	unknown	Het
Zfp236	G	T	18: 82,682,156	Q63K	probably benign	Het
Zfp7	T	A	15: 76,890,854	C365*	probably null	Het
Zfp786	T	C	6: 47,819,685	E773G	probably damaging	Het

Other mutations in Slf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00942:Slf1	APN	13	77043947	missense	possibly damaging	0.95
IGL01105:Slf1	APN	13	77100912	unclassified	probably benign
IGL01108:Slf1	APN	13	77125475	splice site	probably benign
IGL01149:Slf1	APN	13	77112648	missense	probably damaging	0.99
IGL01642:Slf1	APN	13	77049915	missense	probably benign	0.00
IGL01757:Slf1	APN	13	77084440	missense	probably benign
IGL01887:Slf1	APN	13	77100982	missense	probably benign	0.02
IGL02323:Slf1	APN	13	77051294	missense	possibly damaging	0.87
IGL02861:Slf1	APN	13	77126359	splice site	probably benign
IGL02971:Slf1	APN	13	77047104	splice site	probably benign
IGL03088:Slf1	APN	13	77084435	missense	probably damaging	1.00
IGL03215:Slf1	APN	13	77049977	missense	probably benign	0.00
IGL02980:Slf1	UTSW	13	77044004	missense	possibly damaging	0.92
PIT1430001:Slf1	UTSW	13	77050050	splice site	probably benign
R0036:Slf1	UTSW	13	77100951	missense	probably benign	0.02
R0036:Slf1	UTSW	13	77100951	missense	probably benign	0.02
R0125:Slf1	UTSW	13	77043745	missense	probably benign	0.02
R0230:Slf1	UTSW	13	77112748	intron	probably benign
R0244:Slf1	UTSW	13	77126632	nonsense	probably null
R0395:Slf1	UTSW	13	77105969	splice site	probably benign
R0614:Slf1	UTSW	13	77049114	missense	probably benign	0.10
R0661:Slf1	UTSW	13	77083596	missense	probably benign	0.31
R0837:Slf1	UTSW	13	77100948	splice site	probably null
R0945:Slf1	UTSW	13	77103471	unclassified	probably benign
R1282:Slf1	UTSW	13	77043840	missense	probably damaging	0.97
R1365:Slf1	UTSW	13	77126371	missense	probably damaging	1.00
R1449:Slf1	UTSW	13	77083449	missense	probably damaging	1.00
R1646:Slf1	UTSW	13	77066648	nonsense	probably null
R2071:Slf1	UTSW	13	77104624	missense	probably benign	0.02
R2141:Slf1	UTSW	13	77049219	critical splice acceptor site	probably null
R2217:Slf1	UTSW	13	77046706	critical splice acceptor site	probably null
R2397:Slf1	UTSW	13	77103583	nonsense	probably null
R2520:Slf1	UTSW	13	77051265	missense	probably damaging	1.00
R3108:Slf1	UTSW	13	77126721	splice site	probably benign
R4178:Slf1	UTSW	13	77043569	missense	probably damaging	1.00
R4663:Slf1	UTSW	13	77126604	missense	probably damaging	1.00
R4730:Slf1	UTSW	13	77046632	missense	probably damaging	1.00
R4910:Slf1	UTSW	13	77043880	missense	probably benign	0.14
R4912:Slf1	UTSW	13	77051294	missense	probably damaging	1.00
R5122:Slf1	UTSW	13	77049987	missense	probably benign	0.01
R5269:Slf1	UTSW	13	77104581	missense	probably benign	0.33
R5336:Slf1	UTSW	13	77106010	makesense	probably null
R5346:Slf1	UTSW	13	77092371	missense	probably benign	0.00
R5568:Slf1	UTSW	13	77046704	missense	probably damaging	1.00
R5622:Slf1	UTSW	13	77049971	missense	probably benign	0.14
R5685:Slf1	UTSW	13	77083479	missense	possibly damaging	0.88
R5792:Slf1	UTSW	13	77066737	missense	probably benign	0.03
R5856:Slf1	UTSW	13	77106087	missense	possibly damaging	0.63
R6109:Slf1	UTSW	13	77126680	missense	probably damaging	0.99
R6245:Slf1	UTSW	13	77084383	missense	probably damaging	1.00
R6338:Slf1	UTSW	13	77084462	critical splice acceptor site	probably null
R6438:Slf1	UTSW	13	77066606	missense	probably damaging	1.00
R6487:Slf1	UTSW	13	77066617	missense	probably damaging	1.00
R6597:Slf1	UTSW	13	77049129	missense	probably benign	0.01
R6600:Slf1	UTSW	13	77083536	missense	probably benign	0.00
R6661:Slf1	UTSW	13	77043845	missense	probably damaging	1.00
R7268:Slf1	UTSW	13	77066707	missense	probably damaging	1.00
R7308:Slf1	UTSW	13	77051168	missense	probably benign	0.19
R7355:Slf1	UTSW	13	77091303	missense	probably damaging	1.00
R7546:Slf1	UTSW	13	77049192	missense	probably benign
R7807:Slf1	UTSW	13	77046704	missense	probably damaging	1.00
R8175:Slf1	UTSW	13	77112671	missense	probably damaging	1.00
R8385:Slf1	UTSW	13	77105990	missense	probably benign
R8698:Slf1	UTSW	13	77049165	missense	possibly damaging	0.78
R8770:Slf1	UTSW	13	77046647	missense	probably damaging	1.00
R8786:Slf1	UTSW	13	77126687	missense	possibly damaging	0.93
R8796:Slf1	UTSW	13	77066665	missense	probably benign	0.00
R8932:Slf1	UTSW	13	77046574	missense	probably damaging	1.00
R9132:Slf1	UTSW	13	77100954	missense	probably benign	0.24
R9243:Slf1	UTSW	13	77125456	missense	possibly damaging	0.95
R9274:Slf1	UTSW	13	77043550	makesense	probably null
R9286:Slf1	UTSW	13	77043813	missense	probably damaging	0.99
R9416:Slf1	UTSW	13	77046537	missense
R9612:Slf1	UTSW	13	77049085	critical splice donor site	probably null
X0018:Slf1	UTSW	13	77051238	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGACCTTGGACATTTTGAGATGAC -3'
(R):5'- ACGGGAGTCATTTGTATTACAGATG -3'

Sequencing Primer
(F):5'- TGGACATTTTGAGATGACAATAAGG -3'
(R):5'- AGGGAATGAGAGTCTTTTATTTGCTC -3'

Posted On

2016-09-01