Incidental Mutation 'R5269:Slf1'
ID400109
Institutional Source Beutler Lab
Gene Symbol Slf1
Ensembl Gene ENSMUSG00000021597
Gene NameSMC5-SMC6 complex localization factor 1
Synonyms2700017A04Rik, Brctx, Brctd1, C730024G01Rik, Ankrd32
MMRRC Submission 042834-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5269 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location77043088-77135473 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 77104581 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 274 (S274T)
Ref Sequence ENSEMBL: ENSMUSP00000124865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000151524] [ENSMUST00000159300] [ENSMUST00000159462] [ENSMUST00000162921] [ENSMUST00000162944]
Predicted Effect probably benign
Transcript: ENSMUST00000151524
AA Change: S274T

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000118312
Gene: ENSMUSG00000021597
AA Change: S274T

DomainStartEndE-ValueType
BRCT 2 80 1.37e-2 SMART
BRCT 121 199 2.12e1 SMART
low complexity region 260 273 N/A INTRINSIC
low complexity region 527 541 N/A INTRINSIC
low complexity region 765 785 N/A INTRINSIC
ANK 802 832 1.52e0 SMART
ANK 836 865 4.32e-5 SMART
ANK 870 900 2.07e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159300
AA Change: S274T

PolyPhen 2 Score 0.331 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124865
Gene: ENSMUSG00000021597
AA Change: S274T

DomainStartEndE-ValueType
BRCT 2 80 1.37e-2 SMART
BRCT 121 199 2.12e1 SMART
low complexity region 260 273 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159462
SMART Domains Protein: ENSMUSP00000124543
Gene: ENSMUSG00000021597

DomainStartEndE-ValueType
BRCT 8 86 1.37e-2 SMART
BRCT 127 205 2.12e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162320
Predicted Effect probably benign
Transcript: ENSMUST00000162921
SMART Domains Protein: ENSMUSP00000124946
Gene: ENSMUSG00000021597

DomainStartEndE-ValueType
BRCT 2 80 1.37e-2 SMART
Blast:BRCT 121 173 1e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162944
SMART Domains Protein: ENSMUSP00000123982
Gene: ENSMUSG00000021597

DomainStartEndE-ValueType
BRCT 2 80 1.37e-2 SMART
Blast:BRCT 121 173 1e-8 BLAST
Meta Mutation Damage Score 0.1304 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 100% (71/71)
MGI Phenotype PHENOTYPE: Homozygous null mice are developmentally normal and fertile with no pathological abnormalities or defects in T-cell development and genomic stability. Mutant MEFs grow at a normal rate and are not more sensitive to DNA-damaging agents while thymocytes donot show any major cell cycle defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 T C 17: 24,376,743 S357P possibly damaging Het
Adam39 A G 8: 40,825,981 I470V probably benign Het
Agrn A T 4: 156,168,990 C1708S probably benign Het
Agtpbp1 A G 13: 59,473,743 I42T probably damaging Het
Akap6 T C 12: 53,139,843 C1347R probably damaging Het
Als2cr12 A G 1: 58,691,760 S46P possibly damaging Het
Antxr1 A G 6: 87,180,183 L452P probably damaging Het
Arhgef33 T A 17: 80,370,275 V417D probably damaging Het
Brca2 A G 5: 150,539,223 I817M possibly damaging Het
Casp4 A T 9: 5,321,521 probably benign Het
Cdh20 T C 1: 104,934,157 Y21H possibly damaging Het
Cdr2 C T 7: 120,958,334 V323M possibly damaging Het
Cebpa G A 7: 35,119,858 R147H probably benign Het
Cetn4 C A 3: 37,309,969 E31* probably null Het
Cobll1 G A 2: 65,133,771 Q189* probably null Het
Colec12 A G 18: 9,846,825 T74A possibly damaging Het
Crisp4 A G 1: 18,128,710 S124P probably damaging Het
Eddm3b T A 14: 51,116,721 D55E probably damaging Het
Elmo1 C A 13: 20,449,486 N439K probably benign Het
Fabp12 T C 3: 10,250,107 N60S probably benign Het
Fam196b G A 11: 34,402,788 E277K probably damaging Het
Fat2 T A 11: 55,287,878 H1452L probably benign Het
Flrt2 T C 12: 95,779,938 V350A possibly damaging Het
Ganab T C 19: 8,911,937 F626S probably damaging Het
Ghr T C 15: 3,320,079 Y539C probably benign Het
Gm6871 T C 7: 41,548,101 T112A probably damaging Het
Gm7133 T A 1: 97,183,123 noncoding transcript Het
Gon4l A C 3: 88,895,528 I1149L probably benign Het
Greb1l G A 18: 10,511,409 D45N probably benign Het
H2-K1 A G 17: 33,997,015 probably benign Het
Herc2 C T 7: 56,168,870 R2770* probably null Het
Itsn2 A G 12: 4,633,553 probably benign Het
Klb A G 5: 65,348,797 D129G probably damaging Het
Klf1 A G 8: 84,903,340 I265V probably benign Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Map3k10 T C 7: 27,658,532 E607G probably benign Het
Melk C T 4: 44,363,730 T592M probably damaging Het
Mroh6 A G 15: 75,885,790 L457P probably damaging Het
Mrpl21 T A 19: 3,287,012 C128S probably damaging Het
Olfr564 T C 7: 102,804,120 V214A probably benign Het
Paqr4 G T 17: 23,738,213 H105Q probably damaging Het
Pcdhga10 A G 18: 37,748,694 I503V probably benign Het
Pds5a T C 5: 65,663,928 N151S probably damaging Het
Pif1 A G 9: 65,591,829 T444A possibly damaging Het
Ppp2r3a T C 9: 101,153,865 R851G probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Ros1 T G 10: 52,051,008 Q2172P probably damaging Het
Rpe65 A G 3: 159,604,347 T86A probably benign Het
Rpl18a G A 8: 70,896,288 R15C possibly damaging Het
Sh3tc2 A G 18: 61,975,613 K258R probably benign Het
Ska3 T A 14: 57,822,116 E84V possibly damaging Het
Slc25a40 T A 5: 8,447,409 probably null Het
Spata21 A T 4: 141,103,021 Q267H probably damaging Het
Strbp A T 2: 37,627,443 W207R possibly damaging Het
Taf6l T C 19: 8,774,962 E454G probably damaging Het
Tcam1 C A 11: 106,285,527 L360I probably benign Het
Tnxb G A 17: 34,703,608 R2465H possibly damaging Het
Trim66 T A 7: 109,457,590 Y1120F probably benign Het
Trp53 T A 11: 69,589,205 M243K probably damaging Het
Ttl T A 2: 129,068,911 C72S probably damaging Het
Ttn A G 2: 76,708,896 V34582A probably benign Het
Uqcrh T C 4: 116,069,904 T31A possibly damaging Het
Usp40 A G 1: 87,995,782 C256R probably benign Het
Vmn1r168 A G 7: 23,541,414 E232G probably benign Het
Wdr72 A T 9: 74,157,371 I562F probably damaging Het
Wnt4 A G 4: 137,277,750 N24S probably benign Het
Other mutations in Slf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Slf1 APN 13 77043947 missense possibly damaging 0.95
IGL01105:Slf1 APN 13 77100912 unclassified probably benign
IGL01108:Slf1 APN 13 77125475 splice site probably benign
IGL01149:Slf1 APN 13 77112648 missense probably damaging 0.99
IGL01642:Slf1 APN 13 77049915 missense probably benign 0.00
IGL01757:Slf1 APN 13 77084440 missense probably benign
IGL01887:Slf1 APN 13 77100982 missense probably benign 0.02
IGL02323:Slf1 APN 13 77051294 missense possibly damaging 0.87
IGL02861:Slf1 APN 13 77126359 splice site probably benign
IGL02971:Slf1 APN 13 77047104 splice site probably benign
IGL03088:Slf1 APN 13 77084435 missense probably damaging 1.00
IGL03215:Slf1 APN 13 77049977 missense probably benign 0.00
IGL02980:Slf1 UTSW 13 77044004 missense possibly damaging 0.92
PIT1430001:Slf1 UTSW 13 77050050 splice site probably benign
R0036:Slf1 UTSW 13 77100951 missense probably benign 0.02
R0036:Slf1 UTSW 13 77100951 missense probably benign 0.02
R0125:Slf1 UTSW 13 77043745 missense probably benign 0.02
R0230:Slf1 UTSW 13 77112748 intron probably benign
R0244:Slf1 UTSW 13 77126632 nonsense probably null
R0395:Slf1 UTSW 13 77105969 splice site probably benign
R0614:Slf1 UTSW 13 77049114 missense probably benign 0.10
R0661:Slf1 UTSW 13 77083596 missense probably benign 0.31
R0837:Slf1 UTSW 13 77100948 unclassified probably null
R0945:Slf1 UTSW 13 77103471 unclassified probably benign
R1282:Slf1 UTSW 13 77043840 missense probably damaging 0.97
R1365:Slf1 UTSW 13 77126371 missense probably damaging 1.00
R1449:Slf1 UTSW 13 77083449 missense probably damaging 1.00
R1646:Slf1 UTSW 13 77066648 nonsense probably null
R2071:Slf1 UTSW 13 77104624 missense probably benign 0.02
R2141:Slf1 UTSW 13 77049219 critical splice acceptor site probably null
R2217:Slf1 UTSW 13 77046706 critical splice acceptor site probably null
R2397:Slf1 UTSW 13 77103583 nonsense probably null
R2520:Slf1 UTSW 13 77051265 missense probably damaging 1.00
R3108:Slf1 UTSW 13 77126721 splice site probably benign
R4178:Slf1 UTSW 13 77043569 missense probably damaging 1.00
R4663:Slf1 UTSW 13 77126604 missense probably damaging 1.00
R4730:Slf1 UTSW 13 77046632 missense probably damaging 1.00
R4910:Slf1 UTSW 13 77043880 missense probably benign 0.14
R4912:Slf1 UTSW 13 77051294 missense probably damaging 1.00
R5122:Slf1 UTSW 13 77049987 missense probably benign 0.01
R5336:Slf1 UTSW 13 77106010 makesense probably null
R5346:Slf1 UTSW 13 77092371 missense probably benign 0.00
R5445:Slf1 UTSW 13 77091204 missense probably benign 0.10
R5568:Slf1 UTSW 13 77046704 missense probably damaging 1.00
R5622:Slf1 UTSW 13 77049971 missense probably benign 0.14
R5685:Slf1 UTSW 13 77083479 missense possibly damaging 0.88
R5792:Slf1 UTSW 13 77066737 missense probably benign 0.03
R5856:Slf1 UTSW 13 77106087 missense possibly damaging 0.63
R6109:Slf1 UTSW 13 77126680 missense probably damaging 0.99
R6245:Slf1 UTSW 13 77084383 missense probably damaging 1.00
R6338:Slf1 UTSW 13 77084462 critical splice acceptor site probably null
R6438:Slf1 UTSW 13 77066606 missense probably damaging 1.00
R6487:Slf1 UTSW 13 77066617 missense probably damaging 1.00
R6597:Slf1 UTSW 13 77049129 missense probably benign 0.01
R6600:Slf1 UTSW 13 77083536 missense probably benign 0.00
R6661:Slf1 UTSW 13 77043845 missense probably damaging 1.00
R7268:Slf1 UTSW 13 77066707 missense probably damaging 1.00
R7308:Slf1 UTSW 13 77051168 missense probably benign 0.19
R7355:Slf1 UTSW 13 77091303 missense probably damaging 1.00
R7546:Slf1 UTSW 13 77049192 missense probably benign
X0018:Slf1 UTSW 13 77051238 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTCCCAGGCAAAATGAGTTC -3'
(R):5'- ACGGAAGTTACCACAGTTGATTCTG -3'

Sequencing Primer
(F):5'- CCCAGGCAAAATGAGTTCATAAATAG -3'
(R):5'- GGCAAACTAAAGCATTTGTTTTCTGG -3'
Posted On2016-07-06