Incidental Mutation 'R6109:Wdr70'
ID484740
Institutional Source Beutler Lab
Gene Symbol Wdr70
Ensembl Gene ENSMUSG00000039828
Gene NameWD repeat domain 70
Synonyms4833422F06Rik
MMRRC Submission 044259-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R6109 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location7873055-8099209 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to T at 8079154 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000037340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045766] [ENSMUST00000045766]
Predicted Effect probably null
Transcript: ENSMUST00000045766
SMART Domains Protein: ENSMUSP00000037340
Gene: ENSMUSG00000039828

DomainStartEndE-ValueType
coiled coil region 51 81 N/A INTRINSIC
low complexity region 137 167 N/A INTRINSIC
WD40 174 213 1.61e-3 SMART
WD40 220 260 3.2e0 SMART
WD40 272 315 1.03e0 SMART
WD40 324 363 1.7e-2 SMART
WD40 367 409 1.38e-2 SMART
Blast:WD40 413 460 5e-16 BLAST
WD40 463 502 3.44e0 SMART
low complexity region 570 586 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000045766
SMART Domains Protein: ENSMUSP00000037340
Gene: ENSMUSG00000039828

DomainStartEndE-ValueType
coiled coil region 51 81 N/A INTRINSIC
low complexity region 137 167 N/A INTRINSIC
WD40 174 213 1.61e-3 SMART
WD40 220 260 3.2e0 SMART
WD40 272 315 1.03e0 SMART
WD40 324 363 1.7e-2 SMART
WD40 367 409 1.38e-2 SMART
Blast:WD40 413 460 5e-16 BLAST
WD40 463 502 3.44e0 SMART
low complexity region 570 586 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 95.0%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T C 19: 11,101,912 M131V possibly damaging Het
Abcc10 T C 17: 46,310,377 Y950C probably benign Het
Acadm A G 3: 153,941,943 C20R probably damaging Het
Agtpbp1 G T 13: 59,473,746 T984K probably damaging Het
Agxt2 C T 15: 10,377,422 T136I probably damaging Het
Ankrd36 C A 11: 5,628,941 N68K probably damaging Het
Ap3b2 T A 7: 81,493,592 D10V possibly damaging Het
Apcdd1 A T 18: 62,937,366 I235F probably damaging Het
Arhgap32 T A 9: 32,260,111 W1396R probably damaging Het
Ascc3 A G 10: 50,649,247 T513A probably benign Het
Aym1 C T 5: 113,357,541 L9F unknown Het
Btnl10 C A 11: 58,920,304 S151Y probably damaging Het
Camk2a A T 18: 60,943,234 K95* probably null Het
Ccdc40 T C 11: 119,231,978 V202A probably benign Het
Cd200r3 T A 16: 44,953,682 D152E probably benign Het
Cd2bp2 C T 7: 127,194,815 D101N probably damaging Het
Cdh20 G A 1: 104,994,014 D679N probably damaging Het
Clpx C T 9: 65,299,952 T44I probably benign Het
Cnnm4 T G 1: 36,498,479 V541G probably damaging Het
Csmd1 T C 8: 16,199,860 I1035V possibly damaging Het
Ctsw T C 19: 5,467,119 S62G probably benign Het
Dlk2 T A 17: 46,301,697 Y109N probably damaging Het
Ebf3 C T 7: 137,206,226 V363M probably damaging Het
Farsb A G 1: 78,463,270 probably null Het
Fastkd3 C T 13: 68,590,218 Q32* probably null Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gk5 C A 9: 96,140,610 F166L probably benign Het
Gm11271 G T 13: 21,381,139 noncoding transcript Het
Gm5294 C A 5: 138,820,095 Q6K probably damaging Het
Gnat2 T A 3: 108,100,135 Y290N probably damaging Het
H2-D1 A T 17: 35,263,937 I148F probably damaging Het
Hdac2 A G 10: 36,986,389 D83G probably null Het
Kdm5d T C Y: 921,501 W500R probably damaging Het
Kel A T 6: 41,688,862 F489I probably benign Het
Kmo C A 1: 175,637,908 A76E possibly damaging Het
Krt32 T C 11: 100,087,965 T88A probably benign Het
Lce3b A G 3: 92,933,687 T30A unknown Het
Lcn11 A G 2: 25,779,296 H155R possibly damaging Het
Lmln T A 16: 33,069,111 I129N possibly damaging Het
Meiob A G 17: 24,813,019 K3E probably benign Het
Mitf C T 6: 97,996,468 T229M probably damaging Het
Muc16 T C 9: 18,655,359 I1955V unknown Het
Naip1 A G 13: 100,427,182 C492R probably damaging Het
Ncor2 C T 5: 125,055,846 A26T probably damaging Het
Ngfr T G 11: 95,578,057 D165A probably damaging Het
Nobox A T 6: 43,305,169 S323R probably damaging Het
Olfr616 T C 7: 103,565,139 I47V probably benign Het
Olfr811 G A 10: 129,801,820 A235V probably damaging Het
Olfr811 C A 10: 129,801,821 A235S probably damaging Het
Olfr937 A G 9: 39,060,196 S157P probably benign Het
Pcdhb1 G T 18: 37,265,253 V86F possibly damaging Het
Pdk1 A G 2: 71,883,506 E165G probably benign Het
Peak1 C T 9: 56,259,283 V454I probably benign Het
Rad9b C T 5: 122,344,297 G125D probably damaging Het
S100a16 T C 3: 90,542,074 F19L probably damaging Het
Serpine2 T C 1: 79,810,671 K190E probably damaging Het
Slf1 A T 13: 77,126,680 M12K probably damaging Het
Tex101 T C 7: 24,668,313 T205A possibly damaging Het
Tssk5 T C 15: 76,373,716 E147G probably damaging Het
Ubr4 A G 4: 139,417,364 T1495A probably damaging Het
Vav3 C T 3: 109,664,365 T201M probably damaging Het
Zfp811 T A 17: 32,797,374 probably null Het
Zscan10 T A 17: 23,607,129 F88L probably damaging Het
Other mutations in Wdr70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Wdr70 APN 15 8019607 missense probably benign 0.07
IGL01121:Wdr70 APN 15 7873174 missense possibly damaging 0.53
IGL01508:Wdr70 APN 15 8079263 missense probably benign 0.33
IGL01801:Wdr70 APN 15 7887324 splice site probably null
IGL01815:Wdr70 APN 15 7887324 splice site probably null
IGL01929:Wdr70 APN 15 7920634 splice site probably null
IGL02150:Wdr70 APN 15 8082546 missense possibly damaging 0.72
IGL02245:Wdr70 APN 15 8046482 missense possibly damaging 0.86
IGL02541:Wdr70 APN 15 7884302 nonsense probably null
IGL02800:Wdr70 APN 15 8082496 missense probably benign 0.25
IGL02829:Wdr70 APN 15 7976982 missense possibly damaging 0.92
IGL02831:Wdr70 APN 15 7884306 missense possibly damaging 0.86
IGL03169:Wdr70 APN 15 7884340 missense possibly damaging 0.73
IGL03405:Wdr70 APN 15 8035871 missense possibly damaging 0.73
R0106:Wdr70 UTSW 15 8019587 critical splice donor site probably null
R0106:Wdr70 UTSW 15 8019587 critical splice donor site probably null
R0462:Wdr70 UTSW 15 8079161 missense probably benign 0.00
R0539:Wdr70 UTSW 15 7885637 missense possibly damaging 0.96
R1398:Wdr70 UTSW 15 8035844 missense probably benign 0.01
R1812:Wdr70 UTSW 15 8079179 missense probably benign 0.00
R1863:Wdr70 UTSW 15 7920573 missense probably benign 0.25
R1913:Wdr70 UTSW 15 7884410 missense possibly damaging 0.72
R2425:Wdr70 UTSW 15 7887359 nonsense probably null
R4013:Wdr70 UTSW 15 8079214 nonsense probably null
R4015:Wdr70 UTSW 15 8079214 nonsense probably null
R4017:Wdr70 UTSW 15 8079214 nonsense probably null
R4111:Wdr70 UTSW 15 7976991 missense probably benign 0.32
R5241:Wdr70 UTSW 15 8079216 missense probably benign
R5277:Wdr70 UTSW 15 7976984 nonsense probably null
R5306:Wdr70 UTSW 15 7924273 missense probably benign 0.04
R5426:Wdr70 UTSW 15 7922105 missense possibly damaging 0.59
R5586:Wdr70 UTSW 15 7884288 missense possibly damaging 0.86
R6010:Wdr70 UTSW 15 7887419 splice site probably null
R6035:Wdr70 UTSW 15 7887349 missense possibly damaging 0.86
R6035:Wdr70 UTSW 15 7887349 missense possibly damaging 0.86
R6139:Wdr70 UTSW 15 8079251 missense probably benign 0.04
R6400:Wdr70 UTSW 15 8042841 missense probably benign 0.32
R6456:Wdr70 UTSW 15 7885637 missense possibly damaging 0.96
R6518:Wdr70 UTSW 15 8079337 missense unknown
R7036:Wdr70 UTSW 15 7884374 missense possibly damaging 0.85
R7056:Wdr70 UTSW 15 7884396 missense possibly damaging 0.53
R7341:Wdr70 UTSW 15 7924244 missense possibly damaging 0.71
R7484:Wdr70 UTSW 15 7922081 missense probably benign 0.23
R7572:Wdr70 UTSW 15 8035846 missense possibly damaging 0.85
R7652:Wdr70 UTSW 15 8079216 missense probably benign
R7886:Wdr70 UTSW 15 8079249 missense probably benign 0.02
R8103:Wdr70 UTSW 15 7977131 missense possibly damaging 0.70
R8214:Wdr70 UTSW 15 7887370 missense probably benign 0.03
R8252:Wdr70 UTSW 15 8042856 splice site probably benign
Predicted Primers PCR Primer
(F):5'- AACGACACGGTAGGATGCTG -3'
(R):5'- ACGACAGTTCTGATTCATCTGACG -3'

Sequencing Primer
(F):5'- AACACTGTGGGTTCAAGCTC -3'
(R):5'- GATGAGCTAATCGGCCCTC -3'
Posted On2017-08-16