Incidental Mutation 'R6177:Cadm4'
List |< first << previous [record 10 of 64] next >> last >|
ID487823
Institutional Source Beutler Lab
Gene Symbol Cadm4
Ensembl Gene ENSMUSG00000054793
Gene Namecell adhesion molecule 4
SynonymsNecl-4, Tsll2, SynCAM 4, Igsf4c
MMRRC Submission 044319-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.741) question?
Stock #R6177 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location24482023-24504539 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24502761 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 342 (V342M)
Ref Sequence ENSEMBL: ENSMUSP00000066880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068023] [ENSMUST00000071361] [ENSMUST00000176880] [ENSMUST00000177205] [ENSMUST00000177228]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068023
AA Change: V342M

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000066880
Gene: ENSMUSG00000054793
AA Change: V342M

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 29 121 3.18e-6 SMART
IG 130 221 7.89e-2 SMART
IGc2 236 298 1.54e-13 SMART
4.1m 344 362 3.37e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000071361
SMART Domains Protein: ENSMUSP00000071318
Gene: ENSMUSG00000064264

DomainStartEndE-ValueType
low complexity region 15 45 N/A INTRINSIC
low complexity region 55 70 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
low complexity region 138 147 N/A INTRINSIC
ZnF_C2H2 149 171 2.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176880
SMART Domains Protein: ENSMUSP00000135601
Gene: ENSMUSG00000064264

DomainStartEndE-ValueType
low complexity region 38 58 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
low complexity region 133 147 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177205
SMART Domains Protein: ENSMUSP00000135750
Gene: ENSMUSG00000064264

DomainStartEndE-ValueType
low complexity region 38 58 N/A INTRINSIC
low complexity region 68 83 N/A INTRINSIC
low complexity region 133 147 N/A INTRINSIC
low complexity region 151 160 N/A INTRINSIC
ZnF_C2H2 162 184 2.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177228
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205820
Meta Mutation Damage Score 0.1009 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.7%
Validation Efficiency 100% (65/65)
MGI Phenotype PHENOTYPE: Mice homozygous for one null allele do not display myelination abnormalities. Mice with ubiquitous conditional deletion of the gene show myelination abnormalities, decreased nerve conduction velocity, hindlimb rigidity, limb grasping, and impaired coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik A G 19: 11,105,750 I102T possibly damaging Het
Abcd2 T C 15: 91,190,693 I306V probably damaging Het
Actrt3 A T 3: 30,598,167 Y259* probably null Het
Ankfy1 G A 11: 72,754,459 C788Y probably benign Het
Ano1 T A 7: 144,678,741 M25L possibly damaging Het
Apol10b A T 15: 77,585,787 D63E possibly damaging Het
Atp6v1c1 C A 15: 38,673,928 S55* probably null Het
C1s2 T G 6: 124,630,001 D296A probably damaging Het
Cabs1 C T 5: 87,979,754 T88I possibly damaging Het
Cat T C 2: 103,473,075 E119G probably damaging Het
Cavin2 G T 1: 51,289,495 S37I probably damaging Het
Cdk5rap2 G A 4: 70,281,482 R802C probably damaging Het
Clip1 A G 5: 123,613,834 probably benign Het
Dhx57 T C 17: 80,272,966 N519S possibly damaging Het
Dpep2 T C 8: 105,986,199 D260G probably damaging Het
Edem1 T A 6: 108,851,198 probably null Het
Epb41l4a A T 18: 33,798,815 probably null Het
Esp1 T C 17: 40,728,832 S3P possibly damaging Het
Fam111a A G 19: 12,587,382 Y165C probably damaging Het
Fstl4 A G 11: 53,168,204 T497A probably benign Het
Gm281 T C 14: 13,868,002 D229G probably benign Het
Gstcd T C 3: 133,082,073 D288G probably damaging Het
Hmcn2 T A 2: 31,420,106 L3264* probably null Het
Hyal4 T A 6: 24,766,090 L481* probably null Het
Ighv2-7 A G 12: 113,807,435 Y77H possibly damaging Het
Jdp2 G T 12: 85,638,840 R125L probably benign Het
Lrp1b A T 2: 41,123,736 probably null Het
Lrp2 AC A 2: 69,510,419 probably null Het
Marveld2 C T 13: 100,597,378 D250N probably damaging Het
Mast3 A G 8: 70,790,018 S53P probably damaging Het
Myo3b T C 2: 70,313,363 V1041A probably benign Het
Nkpd1 T A 7: 19,523,084 F113I probably damaging Het
Obscn A G 11: 59,032,664 S6470P probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr1015 C T 2: 85,785,660 R50C probably damaging Het
Olfr1246 T C 2: 89,590,317 D266G possibly damaging Het
Pdcd11 G T 19: 47,120,283 G1246V probably damaging Het
Phc3 A T 3: 30,942,565 S219T probably damaging Het
Plxnb1 C T 9: 109,102,925 probably null Het
Polh T C 17: 46,184,744 D276G possibly damaging Het
Polq T A 16: 37,071,709 V1991E probably damaging Het
Polr2g G A 19: 8,794,177 R144C probably damaging Het
Pramef25 G A 4: 143,949,006 H417Y possibly damaging Het
Prex2 A C 1: 11,136,777 T520P possibly damaging Het
Psg21 T A 7: 18,652,354 T236S possibly damaging Het
Ptpru A T 4: 131,793,525 S761R probably benign Het
Rapgef6 G A 11: 54,620,016 R253Q probably damaging Het
Rc3h2 C T 2: 37,389,646 V524I probably benign Het
Sde2 T C 1: 180,858,219 V112A probably damaging Het
Sept7 T C 9: 25,293,804 probably null Het
Spef2 A G 15: 9,727,532 V155A possibly damaging Het
St7 T C 6: 17,819,334 probably null Het
Tmcc3 A T 10: 94,582,387 Y339F probably damaging Het
Tmed6 T C 8: 107,065,451 E54G probably damaging Het
Tnks1bp1 C T 2: 85,059,280 probably benign Het
Trim43c T C 9: 88,840,547 L82P possibly damaging Het
Txndc2 T C 17: 65,638,471 D237G probably benign Het
Vmn1r91 T A 7: 20,101,479 C108S possibly damaging Het
Vtn A T 11: 78,500,010 D165V probably damaging Het
Wdr3 A T 3: 100,161,152 S13R probably damaging Het
Zdhhc16 A G 19: 41,937,759 Y31C probably benign Het
Zfp39 A T 11: 58,891,061 W292R probably benign Het
Zfp612 A T 8: 110,089,974 L604F probably damaging Het
Other mutations in Cadm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01094:Cadm4 APN 7 24502759 missense possibly damaging 0.56
IGL01369:Cadm4 APN 7 24499522 missense possibly damaging 0.50
IGL02134:Cadm4 APN 7 24499561 missense probably benign 0.00
IGL03037:Cadm4 APN 7 24500795 missense probably damaging 1.00
IGL03086:Cadm4 APN 7 24500815 missense probably damaging 0.96
R0024:Cadm4 UTSW 7 24502744 missense probably benign 0.28
R1444:Cadm4 UTSW 7 24503621 makesense probably null
R6389:Cadm4 UTSW 7 24499534 missense probably benign 0.33
R7143:Cadm4 UTSW 7 24499567 missense possibly damaging 0.85
R7822:Cadm4 UTSW 7 24503545 missense possibly damaging 0.62
R8134:Cadm4 UTSW 7 24503605 missense possibly damaging 0.85
X0026:Cadm4 UTSW 7 24499924 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- CCAAGGATTCTCAGAAGAACTGG -3'
(R):5'- ATCTCAGCCCTTTCAGAGCC -3'

Sequencing Primer
(F):5'- CATTCAAGGAGCAAAGCTATGTGC -3'
(R):5'- CCCTTTCAGAGCCCAGGG -3'
Posted On2017-10-10