Incidental Mutation 'R6155:Pusl1'
ID489511
Institutional Source Beutler Lab
Gene Symbol Pusl1
Ensembl Gene ENSMUSG00000051557
Gene Namepseudouridylate synthase-like 1
Synonyms
MMRRC Submission 044302-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R6155 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location155887879-155891781 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 155890548 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 199 (S199P)
Ref Sequence ENSEMBL: ENSMUSP00000095344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030901] [ENSMUST00000079031] [ENSMUST00000097737] [ENSMUST00000105584] [ENSMUST00000120794] [ENSMUST00000156460]
Predicted Effect probably benign
Transcript: ENSMUST00000030901
SMART Domains Protein: ENSMUSP00000030901
Gene: ENSMUSG00000029034

DomainStartEndE-ValueType
Lactamase_B 16 233 3.38e-17 SMART
Beta-Casp 245 363 6.94e-37 SMART
Pfam:RMMBL 376 418 1.1e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079031
SMART Domains Protein: ENSMUSP00000078040
Gene: ENSMUSG00000029033

DomainStartEndE-ValueType
low complexity region 17 31 N/A INTRINSIC
PH 265 361 6.35e-16 SMART
low complexity region 377 391 N/A INTRINSIC
ArfGap 399 521 4.62e-56 SMART
low complexity region 554 566 N/A INTRINSIC
low complexity region 601 617 N/A INTRINSIC
low complexity region 628 650 N/A INTRINSIC
low complexity region 669 686 N/A INTRINSIC
ANK 696 725 3.91e-3 SMART
ANK 729 758 2.43e1 SMART
low complexity region 781 796 N/A INTRINSIC
low complexity region 797 809 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097737
AA Change: S199P

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000095344
Gene: ENSMUSG00000051557
AA Change: S199P

DomainStartEndE-ValueType
Pfam:PseudoU_synth_1 16 124 2.5e-12 PFAM
Pfam:PseudoU_synth_1 168 285 1.1e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105584
SMART Domains Protein: ENSMUSP00000101209
Gene: ENSMUSG00000029033

DomainStartEndE-ValueType
Pfam:BAR_3 3 236 4.1e-95 PFAM
PH 269 365 6.35e-16 SMART
low complexity region 381 395 N/A INTRINSIC
ArfGap 403 525 4.62e-56 SMART
low complexity region 558 570 N/A INTRINSIC
low complexity region 605 621 N/A INTRINSIC
low complexity region 632 654 N/A INTRINSIC
low complexity region 673 690 N/A INTRINSIC
ANK 700 729 3.91e-3 SMART
ANK 733 762 2.43e1 SMART
low complexity region 785 800 N/A INTRINSIC
low complexity region 801 813 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120794
SMART Domains Protein: ENSMUSP00000112656
Gene: ENSMUSG00000029034

DomainStartEndE-ValueType
Lactamase_B 16 211 6.42e-9 SMART
Beta-Casp 223 341 6.94e-37 SMART
Pfam:RMMBL 354 396 3.6e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126582
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130146
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131168
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135844
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142724
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150446
Predicted Effect probably benign
Transcript: ENSMUST00000156460
SMART Domains Protein: ENSMUSP00000118803
Gene: ENSMUSG00000029034

DomainStartEndE-ValueType
SCOP:d1smla_ 1 66 7e-7 SMART
PDB:2I7V|A 3 38 1e-9 PDB
Blast:Lactamase_B 16 66 4e-30 BLAST
Meta Mutation Damage Score 0.1 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg3 T C 5: 104,963,644 Y319C probably benign Het
Actn4 A C 7: 28,896,141 I763S probably damaging Het
Actr8 G A 14: 29,978,589 probably null Het
Adrb1 T C 19: 56,722,904 L178P probably damaging Het
Afap1 A G 5: 35,935,609 Y19C unknown Het
Ankrd36 A G 11: 5,687,442 E1337G probably benign Het
Arl4a A C 12: 40,036,520 V76G probably damaging Het
B230118H07Rik A T 2: 101,576,010 probably null Het
Bmp1 A T 14: 70,508,007 I246K probably damaging Het
Camk4 A T 18: 32,939,447 T18S unknown Het
Cep152 T C 2: 125,581,700 H927R probably benign Het
Clca3a2 A G 3: 144,819,357 I38T probably damaging Het
Clec2g A C 6: 128,980,273 T54P probably damaging Het
Cox20 A G 1: 178,321,797 E31G possibly damaging Het
Crispld1 T A 1: 17,753,017 H407Q probably benign Het
Csmd1 T C 8: 15,903,231 I3417V probably benign Het
Dhtkd1 A C 2: 5,910,359 H700Q probably null Het
Dnah10 G A 5: 124,770,599 V1516M probably damaging Het
Dnah10 A G 5: 124,785,175 T2165A probably damaging Het
Dock2 C G 11: 34,294,123 M1072I probably benign Het
F11 T A 8: 45,252,082 T141S probably damaging Het
Gabra6 T A 11: 42,316,523 I245F probably damaging Het
Gm13101 T A 4: 143,965,142 H337L probably benign Het
Gm8909 G A 17: 36,167,507 A211V possibly damaging Het
Herc1 T A 9: 66,433,423 C1685S possibly damaging Het
Il20 G T 1: 130,910,740 D73E probably damaging Het
Ireb2 C A 9: 54,886,527 P247Q probably damaging Het
Kcng3 T C 17: 83,588,378 I220V probably benign Het
Lce1j T G 3: 92,789,072 Q133P unknown Het
Lgals9 C T 11: 78,963,505 A287T probably benign Het
Lrrc52 A G 1: 167,466,727 probably benign Het
Map3k5 A T 10: 20,118,441 H1027L probably benign Het
Morc3 A G 16: 93,862,425 D407G possibly damaging Het
Myom1 T C 17: 71,108,695 probably null Het
Ncapg2 T C 12: 116,438,011 F673S possibly damaging Het
Ncoa6 T C 2: 155,407,448 D1312G probably damaging Het
Nkx1-1 A T 5: 33,431,051 F298I probably damaging Het
Npas2 G A 1: 39,287,476 R14Q probably damaging Het
Npas4 C T 19: 4,986,870 C422Y probably damaging Het
Olfr1230 A G 2: 89,296,421 L283S probably damaging Het
Olfr1381 T A 11: 49,552,584 I279N possibly damaging Het
Olfr481 T C 7: 108,081,286 V164A probably benign Het
Olfr749 T C 14: 50,736,619 D181G probably benign Het
Pcdhga4 T C 18: 37,686,493 I365T probably damaging Het
Pear1 T A 3: 87,759,568 T37S probably damaging Het
Pkn2 A T 3: 142,853,693 F24I probably benign Het
Plcb3 G A 19: 6,966,165 A122V probably damaging Het
Pnliprp1 T C 19: 58,730,133 probably null Het
Psmb3 T A 11: 97,712,452 F164I probably damaging Het
Ptch2 T A 4: 117,096,908 F45Y probably damaging Het
Ptpn23 C A 9: 110,387,781 probably benign Het
Rasgrp2 C A 19: 6,402,501 L35I probably damaging Het
Rictor T C 15: 6,793,977 L1545P probably benign Het
Rtn4r A T 16: 18,151,394 M229L probably benign Het
Ruvbl1 A T 6: 88,479,125 probably null Het
Slc35b3 A T 13: 38,944,596 S30T probably damaging Het
Sorcs3 T C 19: 48,398,697 V207A possibly damaging Het
Sox13 A G 1: 133,393,267 S2P probably damaging Het
Sptbn1 A C 11: 30,137,403 L999R probably damaging Het
Taf4 A G 2: 179,913,524 V1015A probably damaging Het
Top3b T C 16: 16,891,509 L687P probably damaging Het
Tpp2 T A 1: 43,956,489 V268E probably damaging Het
Ttc6 T C 12: 57,737,616 Y1824H possibly damaging Het
Txk A G 5: 72,700,726 Y360H probably damaging Het
Vmn2r57 T C 7: 41,428,690 I115V probably benign Het
Vmn2r98 T C 17: 19,065,881 S214P possibly damaging Het
Zbtb48 T C 4: 152,022,038 probably null Het
Zzz3 A G 3: 152,427,682 I126V possibly damaging Het
Other mutations in Pusl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01765:Pusl1 APN 4 155889713 missense probably damaging 0.96
IGL02056:Pusl1 APN 4 155890572 missense probably benign 0.05
R4377:Pusl1 UTSW 4 155890580 missense probably benign
R4501:Pusl1 UTSW 4 155889542 missense probably benign 0.00
R4893:Pusl1 UTSW 4 155889541 missense probably benign 0.20
R4911:Pusl1 UTSW 4 155891442 unclassified probably benign
R6029:Pusl1 UTSW 4 155889463 missense probably damaging 1.00
R6732:Pusl1 UTSW 4 155891116 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTAGGCCCAATGGATGTGC -3'
(R):5'- CAAAATGTATGCTGGGCTCTG -3'

Sequencing Primer
(F):5'- CTAGGCCCAATGGATGTGCAATATAC -3'
(R):5'- TGCTGGGCTCTGCAGACAG -3'
Posted On2017-10-10