Incidental Mutation 'R4116:Nek5'
ID500504
Institutional Source Beutler Lab
Gene Symbol Nek5
Ensembl Gene ENSMUSG00000037738
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 5
Synonyms
MMRRC Submission 040859-MU
Accession Numbers

Genbank: NM_177898.4; Ensembl: ENSMUST00000081815, ENSMUST00000169834

Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R4116 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location22073616-22125053 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 22111162 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 181 (T181M)
Ref Sequence ENSEMBL: ENSMUSP00000148211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169834] [ENSMUST00000209656]
Predicted Effect probably damaging
Transcript: ENSMUST00000169834
AA Change: T181M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126705
Gene: ENSMUSG00000037738
AA Change: T181M

DomainStartEndE-ValueType
S_TKc 4 255 3.77e-92 SMART
Blast:S_TKc 396 497 3e-37 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000209656
AA Change: T181M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect unknown
Transcript: ENSMUST00000210824
AA Change: T131M
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213644
Meta Mutation Damage Score 0.2982 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit progressive hearing impairment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 A T 17: 46,323,891 F395L possibly damaging Het
Amigo1 C T 3: 108,188,445 T420I probably damaging Het
Ankrd34c A G 9: 89,729,874 L138P probably damaging Het
Cald1 C T 6: 34,745,719 R107C probably damaging Het
Cast C T 13: 74,724,837 E444K probably damaging Het
Crybg1 T G 10: 43,999,162 N650T possibly damaging Het
Cyp19a1 T A 9: 54,168,741 R276S possibly damaging Het
Cyp2c66 A G 19: 39,176,559 D328G possibly damaging Het
Gm6588 A G 5: 112,450,511 E308G probably damaging Het
Hectd1 A T 12: 51,768,723 L1527* probably null Het
Hoxd13 C A 2: 74,668,488 A60E possibly damaging Het
Igkv3-7 G T 6: 70,607,939 G88C probably damaging Het
Kcnk12 GGCATCGC GGCATCGCATCGC 17: 87,746,156 probably null Het
Klhl30 C A 1: 91,354,108 Q144K probably benign Het
Kprp A T 3: 92,823,968 S592T probably damaging Het
Man2c1 T C 9: 57,140,305 probably null Het
Mbtps1 A T 8: 119,541,652 M260K probably benign Het
Morc3 G A 16: 93,873,339 D801N probably benign Het
Mpped1 A G 15: 83,796,709 probably benign Het
Mtcl1 T C 17: 66,366,481 T767A probably benign Het
Nomo1 T C 7: 46,033,896 I22T probably benign Het
Olfr845 T G 9: 19,338,644 F61L probably benign Het
Plin4 A G 17: 56,102,113 V1369A probably benign Het
Polr3c A T 3: 96,715,244 F365Y probably damaging Het
Sec22a A G 16: 35,318,832 F232S probably damaging Het
Sema4f G A 6: 82,917,906 T436M probably benign Het
Sf3a2 A G 10: 80,801,341 T37A probably damaging Het
Slc1a6 A G 10: 78,787,889 M41V probably benign Het
Sptbn4 C T 7: 27,391,570 E1399K probably damaging Het
Sspo T C 6: 48,456,994 L911P probably damaging Het
Sult2a2 A T 7: 13,734,783 Q58L probably benign Het
Syne2 A T 12: 75,931,079 I1433F probably damaging Het
Synm C T 7: 67,734,657 V644I possibly damaging Het
Tbc1d5 A G 17: 50,920,587 L210P probably damaging Het
Trak1 T C 9: 121,448,843 Y229H probably damaging Het
Unc5b G T 10: 60,774,700 T446K probably damaging Het
Wdr95 C A 5: 149,597,575 D604E probably benign Het
Zfp773 AGCTGCTGCTGCTGCTGCTGCTGCTGC AGCTGCTGCTGCTGCTGCTGCTGC 7: 7,133,093 probably benign Het
Other mutations in Nek5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Nek5 APN 8 22111183 missense possibly damaging 0.75
IGL01418:Nek5 APN 8 22095269 missense probably damaging 1.00
IGL01485:Nek5 APN 8 22083369 missense probably benign 0.05
IGL01640:Nek5 APN 8 22120840 missense probably benign 0.00
IGL01894:Nek5 APN 8 22113819 missense probably damaging 1.00
IGL01958:Nek5 APN 8 22096826 missense probably benign 0.09
IGL02332:Nek5 APN 8 22095261 missense probably benign 0.14
IGL02718:Nek5 APN 8 22097463 missense probably benign 0.15
IGL03203:Nek5 APN 8 22118768 missense probably damaging 1.00
IGL03325:Nek5 APN 8 22079142 missense probably benign
R0257:Nek5 UTSW 8 22123672 intron probably benign
R0522:Nek5 UTSW 8 22088797 splice site probably benign
R0525:Nek5 UTSW 8 22079077 unclassified probably benign
R1476:Nek5 UTSW 8 22096731 missense possibly damaging 0.86
R1483:Nek5 UTSW 8 22096790 missense probably benign 0.30
R1764:Nek5 UTSW 8 22109912 missense probably damaging 0.98
R1892:Nek5 UTSW 8 22107729 missense probably benign 0.11
R1989:Nek5 UTSW 8 22111169 missense probably damaging 1.00
R2229:Nek5 UTSW 8 22113632 missense possibly damaging 0.76
R4114:Nek5 UTSW 8 22111162 missense probably damaging 1.00
R4709:Nek5 UTSW 8 22083427 missense probably damaging 0.99
R4952:Nek5 UTSW 8 22096799 missense probably benign 0.00
R4952:Nek5 UTSW 8 22079088 missense probably benign 0.00
R5185:Nek5 UTSW 8 22083381 missense possibly damaging 0.78
R5816:Nek5 UTSW 8 22096736 missense probably benign 0.02
R5884:Nek5 UTSW 8 22088801 critical splice donor site probably null
R6009:Nek5 UTSW 8 22120822 missense probably benign 0.00
R6279:Nek5 UTSW 8 22107721 missense probably benign
R6300:Nek5 UTSW 8 22107721 missense probably benign
R6437:Nek5 UTSW 8 22085460 missense possibly damaging 0.95
R7034:Nek5 UTSW 8 22107723 missense probably benign 0.00
R7036:Nek5 UTSW 8 22107723 missense probably benign 0.00
R7278:Nek5 UTSW 8 22090484 missense probably benign 0.13
R7436:Nek5 UTSW 8 22108040 missense probably damaging 1.00
R7666:Nek5 UTSW 8 22090517 missense probably benign 0.12
R7827:Nek5 UTSW 8 22083387 missense possibly damaging 0.91
R8057:Nek5 UTSW 8 22088906 missense probably benign 0.21
R8350:Nek5 UTSW 8 22113672 missense probably damaging 0.98
R8847:Nek5 UTSW 8 22123579 missense probably benign 0.01
R8888:Nek5 UTSW 8 22090479 critical splice donor site probably null
X0012:Nek5 UTSW 8 22095248 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AAGTCCAAAGGCTTCAGGG -3'
(R):5'- AGTCTGTGGTTCATATGCAATGTC -3'

Sequencing Primer
(F):5'- GGCTTCAGGGAATATTATTCGTCAC -3'
(R):5'- GAACTCACTTTGTAGACCAGGCTG -3'
Posted On2017-12-01