Incidental Mutation 'R6009:Nek5'
ID479652
Institutional Source Beutler Lab
Gene Symbol Nek5
Ensembl Gene ENSMUSG00000037738
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 5
Synonyms
MMRRC Submission 044186-MU
Accession Numbers

Genbank: NM_177898.4; Ensembl: ENSMUST00000081815, ENSMUST00000169834

Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R6009 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location22073616-22125053 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22120822 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 55 (E55G)
Ref Sequence ENSEMBL: ENSMUSP00000148211 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169834] [ENSMUST00000209656]
Predicted Effect probably benign
Transcript: ENSMUST00000169834
AA Change: E55G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000126705
Gene: ENSMUSG00000037738
AA Change: E55G

DomainStartEndE-ValueType
S_TKc 4 255 3.77e-92 SMART
Blast:S_TKc 396 497 3e-37 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000209656
AA Change: E55G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
Predicted Effect probably benign
Transcript: ENSMUST00000210824
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency 100% (53/53)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit progressive hearing impairment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actr8 A G 14: 29,978,497 probably benign Het
Afap1 T C 5: 35,997,560 S683P probably damaging Het
Chid1 T A 7: 141,529,580 D131V probably damaging Het
Clstn2 C T 9: 97,456,526 R860Q probably benign Het
Crlf1 A C 8: 70,503,479 K403T probably damaging Het
Ctdspl2 T G 2: 121,988,838 N201K probably benign Het
Cyb561a3 G A 19: 10,586,808 V171I possibly damaging Het
Dazap1 T C 10: 80,285,304 probably benign Het
Dbf4 G T 5: 8,403,718 Q235K probably damaging Het
Dgka C T 10: 128,723,679 G471D probably damaging Het
Fam13b A T 18: 34,497,405 F100Y possibly damaging Het
Flii A T 11: 60,720,757 L376* probably null Het
Fnip1 G T 11: 54,502,271 G487V probably damaging Het
Gm7247 C T 14: 51,364,348 S26F probably benign Het
Golgb1 G T 16: 36,914,959 A1523S probably damaging Het
Gstm4 A G 3: 108,043,343 V114A possibly damaging Het
Gtf3c1 A G 7: 125,647,430 F1569S possibly damaging Het
Gtf3c5 A T 2: 28,571,165 D312E probably benign Het
Gtpbp1 G A 15: 79,712,096 V149M probably damaging Het
Hoxa7 C T 6: 52,217,387 V7M probably damaging Het
Il17f C T 1: 20,779,286 probably null Het
Ints9 T C 14: 65,008,082 V263A probably benign Het
Kansl1l C T 1: 66,735,600 C689Y probably benign Het
Kctd7 G A 5: 130,145,198 G39E probably damaging Het
Krt82 T A 15: 101,545,105 D282V probably benign Het
Lemd1 G T 1: 132,228,252 E11* probably null Het
Maml2 A G 9: 13,620,998 T503A probably benign Het
Mief2 A G 11: 60,731,659 T352A probably benign Het
Msantd1 C A 5: 34,917,705 T37K probably benign Het
Mtus2 A G 5: 148,306,652 E94G probably damaging Het
Naaa A T 5: 92,259,581 L353Q probably benign Het
Npat T C 9: 53,563,449 M847T probably damaging Het
Nus1 G A 10: 52,433,443 V268I probably benign Het
Olfr550 A G 7: 102,578,594 N33S possibly damaging Het
Parn C T 16: 13,667,564 D23N probably damaging Het
Pdgfa T C 5: 138,979,199 E176G probably damaging Het
Plcl1 T A 1: 55,696,246 F249I probably damaging Het
Plscr5 C T 9: 92,204,435 Q153* probably null Het
Polr2b T C 5: 77,320,252 I133T probably benign Het
Polr3c A G 3: 96,713,614 S463P probably damaging Het
Pprc1 A T 19: 46,071,732 I1530L probably damaging Het
Prex1 C T 2: 166,581,984 S996N probably damaging Het
Rnf169 C A 7: 99,927,123 R291S possibly damaging Het
Setd5 A G 6: 113,110,519 K127R probably damaging Het
Slc25a26 G T 6: 94,510,826 V89L probably benign Het
Slc4a10 A G 2: 62,046,690 T16A probably benign Het
Smchd1 A T 17: 71,440,956 H430Q probably damaging Het
Ttll7 A T 3: 146,934,535 D503V probably damaging Het
Vav2 A T 2: 27,271,900 probably null Het
Zfp345 A T 2: 150,472,517 C367S probably damaging Het
Zfp651 T C 9: 121,762,871 S86P possibly damaging Het
Zfp964 T A 8: 69,663,456 H235Q possibly damaging Het
Other mutations in Nek5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01287:Nek5 APN 8 22111183 missense possibly damaging 0.75
IGL01418:Nek5 APN 8 22095269 missense probably damaging 1.00
IGL01485:Nek5 APN 8 22083369 missense probably benign 0.05
IGL01640:Nek5 APN 8 22120840 missense probably benign 0.00
IGL01894:Nek5 APN 8 22113819 missense probably damaging 1.00
IGL01958:Nek5 APN 8 22096826 missense probably benign 0.09
IGL02332:Nek5 APN 8 22095261 missense probably benign 0.14
IGL02718:Nek5 APN 8 22097463 missense probably benign 0.15
IGL03203:Nek5 APN 8 22118768 missense probably damaging 1.00
IGL03325:Nek5 APN 8 22079142 missense probably benign
R0257:Nek5 UTSW 8 22123672 intron probably benign
R0522:Nek5 UTSW 8 22088797 splice site probably benign
R0525:Nek5 UTSW 8 22079077 unclassified probably benign
R1476:Nek5 UTSW 8 22096731 missense possibly damaging 0.86
R1483:Nek5 UTSW 8 22096790 missense probably benign 0.30
R1764:Nek5 UTSW 8 22109912 missense probably damaging 0.98
R1892:Nek5 UTSW 8 22107729 missense probably benign 0.11
R1989:Nek5 UTSW 8 22111169 missense probably damaging 1.00
R2229:Nek5 UTSW 8 22113632 missense possibly damaging 0.76
R4114:Nek5 UTSW 8 22111162 missense probably damaging 1.00
R4116:Nek5 UTSW 8 22111162 missense probably damaging 1.00
R4709:Nek5 UTSW 8 22083427 missense probably damaging 0.99
R4952:Nek5 UTSW 8 22079088 missense probably benign 0.00
R4952:Nek5 UTSW 8 22096799 missense probably benign 0.00
R5185:Nek5 UTSW 8 22083381 missense possibly damaging 0.78
R5816:Nek5 UTSW 8 22096736 missense probably benign 0.02
R5884:Nek5 UTSW 8 22088801 critical splice donor site probably null
R6279:Nek5 UTSW 8 22107721 missense probably benign
R6300:Nek5 UTSW 8 22107721 missense probably benign
R6437:Nek5 UTSW 8 22085460 missense possibly damaging 0.95
R7034:Nek5 UTSW 8 22107723 missense probably benign 0.00
R7036:Nek5 UTSW 8 22107723 missense probably benign 0.00
R7278:Nek5 UTSW 8 22090484 missense probably benign 0.13
R7436:Nek5 UTSW 8 22108040 missense probably damaging 1.00
R7666:Nek5 UTSW 8 22090517 missense probably benign 0.12
R7827:Nek5 UTSW 8 22083387 missense possibly damaging 0.91
R8057:Nek5 UTSW 8 22088906 missense not run
X0012:Nek5 UTSW 8 22095248 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GGGACATGGAAGACCTCATC -3'
(R):5'- GCCCTGCCTTCAAGAGATAAG -3'

Sequencing Primer
(F):5'- GACATGGAAGACCTCATCTAAAAAG -3'
(R):5'- GTTCTAAAAGTGACGTTAAAGCCAG -3'
Posted On2017-06-26