Incidental Mutation 'R6186:Fam205c'
ID502157
Institutional Source Beutler Lab
Gene Symbol Fam205c
Ensembl Gene ENSMUSG00000050141
Gene Namefamily with sequence similarity 205, member C
SynonymsBC049635
MMRRC Submission 044326-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R6186 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location42868004-42874234 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42872000 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 125 (K125R)
Ref Sequence ENSEMBL: ENSMUSP00000103612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055944] [ENSMUST00000107978]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055944
AA Change: K125R

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000060318
Gene: ENSMUSG00000050141
AA Change: K125R

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DUF4599 51 139 2.7e-31 PFAM
internal_repeat_1 147 168 5.83e-10 PROSPERO
internal_repeat_1 180 201 5.83e-10 PROSPERO
low complexity region 278 289 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107978
AA Change: K125R

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000103612
Gene: ENSMUSG00000050141
AA Change: K125R

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DUF4599 52 138 3.4e-28 PFAM
internal_repeat_1 147 168 5.79e-10 PROSPERO
internal_repeat_1 180 201 5.79e-10 PROSPERO
low complexity region 278 289 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144112
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA792892 T A 5: 94,383,976 Y240N probably benign Het
Adgb A G 10: 10,422,758 S409P probably damaging Het
Adgrg5 T C 8: 94,934,024 V93A possibly damaging Het
Akap8l C T 17: 32,333,044 V420I probably benign Het
Ankrd36 T G 11: 5,643,812 D472E possibly damaging Het
Apbb1 T C 7: 105,567,726 E250G probably damaging Het
AW549877 C A 15: 3,986,369 D238Y possibly damaging Het
Cacna2d4 G A 6: 119,281,689 E579K possibly damaging Het
Capn7 G T 14: 31,370,918 G780W probably damaging Het
Celsr1 T C 15: 85,921,193 E2419G possibly damaging Het
Cep164 A T 9: 45,794,109 S363R probably damaging Het
Cfap221 T A 1: 119,934,610 I581F probably damaging Het
Cog2 C A 8: 124,546,686 T588N probably damaging Het
Cyp2a5 T C 7: 26,843,388 probably benign Het
Cyp2j6 G C 4: 96,536,086 L145V probably damaging Het
Evx1 T C 6: 52,314,218 probably null Het
Fam186a T C 15: 99,947,325 H346R unknown Het
Fam53b T A 7: 132,715,716 D399V possibly damaging Het
Fcho2 T A 13: 98,815,083 N9I probably benign Het
Fjx1 T C 2: 102,450,807 E261G probably benign Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Fkbpl T C 17: 34,646,179 F307S probably benign Het
Fn1 A G 1: 71,637,290 I594T probably damaging Het
Inpp4b T A 8: 82,046,234 V719E probably damaging Het
Ldlr C T 9: 21,723,759 probably benign Het
Macf1 A G 4: 123,484,175 V1419A probably damaging Het
Mapkap1 A G 2: 34,563,114 T340A possibly damaging Het
Mark2 A G 19: 7,283,202 V403A probably benign Het
Mast3 T C 8: 70,785,483 T521A probably damaging Het
Mkl1 T C 15: 81,016,652 K546R probably damaging Het
Myo1h C T 5: 114,319,803 T125I possibly damaging Het
Ndufa8 A G 2: 36,039,740 V118A probably benign Het
Nphs1 A G 7: 30,465,634 T551A probably damaging Het
Olfr267 T C 4: 58,784,948 Y258C probably damaging Het
Olfr726 T A 14: 50,084,525 D52V probably damaging Het
Pcm1 T C 8: 41,293,793 L1343P probably benign Het
Pdcd1 T A 1: 94,040,121 R202* probably null Het
Prkab2 A G 3: 97,663,991 probably null Het
Ptdss2 T C 7: 141,154,949 probably benign Het
Rap1b G T 10: 117,820,552 F78L probably damaging Het
Rbl2 C T 8: 91,106,730 T711I probably damaging Het
Rhobtb2 A G 14: 69,798,244 I126T probably damaging Het
Rnf123 A C 9: 108,069,958 S210A possibly damaging Het
Shank1 T A 7: 44,352,566 F1228L probably benign Het
Sumo1 C A 1: 59,644,570 V38L probably benign Het
Sycp2 C T 2: 178,383,560 S363N probably damaging Het
Tbx2 G T 11: 85,837,846 E352* probably null Het
Timm44 T C 8: 4,266,824 N270D probably damaging Het
Topaz1 A T 9: 122,748,826 Q267L probably benign Het
Trp63 T C 16: 25,876,733 probably benign Het
Ushbp1 T A 8: 71,391,003 T264S possibly damaging Het
Vav3 A G 3: 109,516,067 Y334C probably damaging Het
Wdr36 G C 18: 32,852,901 A553P probably benign Het
Zfhx2 A T 14: 55,063,160 I2378K probably damaging Het
Zfp276 T A 8: 123,255,933 Y145* probably null Het
Zfp458 T C 13: 67,257,637 E246G probably damaging Het
Zfp526 A G 7: 25,226,136 T607A probably benign Het
Other mutations in Fam205c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Fam205c APN 4 42868564 missense probably benign 0.40
IGL01697:Fam205c APN 4 42874163 missense probably benign
IGL02413:Fam205c APN 4 42868549 missense probably damaging 0.99
IGL02450:Fam205c APN 4 42874127 missense probably benign
R0433:Fam205c UTSW 4 42874013 splice site probably benign
R1580:Fam205c UTSW 4 42874020 splice site probably null
R2042:Fam205c UTSW 4 42874030 missense possibly damaging 0.96
R2102:Fam205c UTSW 4 42868558 missense probably benign 0.00
R3824:Fam205c UTSW 4 42873492 critical splice donor site probably null
R4192:Fam205c UTSW 4 42874185 utr 5 prime probably benign
R4668:Fam205c UTSW 4 42871608 missense probably benign 0.00
R4690:Fam205c UTSW 4 42873032 splice site probably null
R5743:Fam205c UTSW 4 42873087 missense probably damaging 0.99
R5868:Fam205c UTSW 4 42871711 missense probably damaging 0.96
R6778:Fam205c UTSW 4 42868522 missense possibly damaging 0.94
R6986:Fam205c UTSW 4 42868696 missense possibly damaging 0.90
R7318:Fam205c UTSW 4 42871823 small deletion probably benign
R7413:Fam205c UTSW 4 42871823 small deletion probably benign
R7675:Fam205c UTSW 4 42871823 small deletion probably benign
R7785:Fam205c UTSW 4 42871823 small deletion probably benign
R7842:Fam205c UTSW 4 42871823 small deletion probably benign
R8125:Fam205c UTSW 4 42873051 missense probably damaging 0.99
RF040:Fam205c UTSW 4 42871823 small deletion probably benign
X0052:Fam205c UTSW 4 42874047 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- AACTGAGCTCTGAACTCTGGTC -3'
(R):5'- AGGAAAGCGGTCTTCATGTAGTC -3'

Sequencing Primer
(F):5'- GGTCATTCAACACTTTGGAGAGCTC -3'
(R):5'- GCGGTCTTCATGTAGTCATTAATAG -3'
Posted On2018-02-27