Incidental Mutation 'R4192:Fam205c'
ID318346
Institutional Source Beutler Lab
Gene Symbol Fam205c
Ensembl Gene ENSMUSG00000050141
Gene Namefamily with sequence similarity 205, member C
SynonymsBC049635
MMRRC Submission 041023-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R4192 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location42868004-42874234 bp(-) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) A to T at 42874185 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055944] [ENSMUST00000107978]
Predicted Effect probably benign
Transcript: ENSMUST00000055944
SMART Domains Protein: ENSMUSP00000060318
Gene: ENSMUSG00000050141

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DUF4599 51 139 2.7e-31 PFAM
internal_repeat_1 147 168 5.83e-10 PROSPERO
internal_repeat_1 180 201 5.83e-10 PROSPERO
low complexity region 278 289 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107978
SMART Domains Protein: ENSMUSP00000103612
Gene: ENSMUSG00000050141

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DUF4599 52 138 3.4e-28 PFAM
internal_repeat_1 147 168 5.79e-10 PROSPERO
internal_repeat_1 180 201 5.79e-10 PROSPERO
low complexity region 278 289 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144112
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik G T 14: 36,096,579 R178L possibly damaging Het
Acot4 T C 12: 84,043,174 probably benign Het
Add3 C A 19: 53,242,524 D543E probably benign Het
Angpt4 A C 2: 151,943,318 D418A probably benign Het
Ano8 A T 8: 71,483,292 V260D probably damaging Het
Cfh C T 1: 140,102,716 R860H possibly damaging Het
Csmd3 T C 15: 47,847,271 D1536G probably damaging Het
Dnajb9 A T 12: 44,207,077 D182E probably benign Het
E330021D16Rik T C 6: 136,401,437 T132A probably benign Het
Epb42 G T 2: 121,030,089 probably null Het
Fam185a T A 5: 21,425,124 probably benign Het
Fer1l6 A G 15: 58,647,149 D1710G probably damaging Het
Gabra2 G A 5: 71,007,998 P210S probably benign Het
Gm8369 C T 19: 11,502,232 P9S probably damaging Het
Il17ra A G 6: 120,481,511 D541G probably damaging Het
Ints4 T G 7: 97,507,733 H337Q probably damaging Het
Itgam A G 7: 128,064,732 T44A probably benign Het
Lyst C A 13: 13,740,513 T3264N probably damaging Het
Macf1 A G 4: 123,473,042 F1077S possibly damaging Het
Myo3a T A 2: 22,407,377 F728I probably damaging Het
Nacad T C 11: 6,605,534 E72G probably benign Het
Nkain3 G A 4: 20,485,003 Q25* probably null Het
Oca2 T C 7: 56,297,249 F342S probably damaging Het
Olfr934 T A 9: 38,983,017 Q9L probably benign Het
Osbpl6 T A 2: 76,585,229 L499Q probably damaging Het
Pcdhgb8 G C 18: 37,763,541 D555H probably damaging Het
Peak1 A T 9: 56,258,741 N634K probably damaging Het
Pitpnm3 T C 11: 72,051,959 K818R possibly damaging Het
Rab3gap1 T A 1: 127,925,470 probably benign Het
Rcc1l T C 5: 134,155,809 T385A probably benign Het
Rrm2 T C 12: 24,708,378 I11T probably benign Het
Scnn1b A G 7: 121,902,739 T207A possibly damaging Het
Syt12 T A 19: 4,447,681 probably benign Het
Tmprss6 A T 15: 78,446,657 probably null Het
Ttbk1 A T 17: 46,479,247 C91S probably damaging Het
Vit A G 17: 78,586,826 H219R probably benign Het
Vmn1r27 A C 6: 58,215,827 I14R probably damaging Het
Other mutations in Fam205c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Fam205c APN 4 42868564 missense probably benign 0.40
IGL01697:Fam205c APN 4 42874163 missense probably benign
IGL02413:Fam205c APN 4 42868549 missense probably damaging 0.99
IGL02450:Fam205c APN 4 42874127 missense probably benign
R0433:Fam205c UTSW 4 42874013 splice site probably benign
R1580:Fam205c UTSW 4 42874020 splice site probably null
R2042:Fam205c UTSW 4 42874030 missense possibly damaging 0.96
R2102:Fam205c UTSW 4 42868558 missense probably benign 0.00
R3824:Fam205c UTSW 4 42873492 critical splice donor site probably null
R4668:Fam205c UTSW 4 42871608 missense probably benign 0.00
R4690:Fam205c UTSW 4 42873032 splice site probably null
R5743:Fam205c UTSW 4 42873087 missense probably damaging 0.99
R5868:Fam205c UTSW 4 42871711 missense probably damaging 0.96
R6186:Fam205c UTSW 4 42872000 missense possibly damaging 0.95
R6778:Fam205c UTSW 4 42868522 missense possibly damaging 0.94
R6986:Fam205c UTSW 4 42868696 missense possibly damaging 0.90
R7318:Fam205c UTSW 4 42871823 small deletion probably benign
R7413:Fam205c UTSW 4 42871823 small deletion probably benign
R7675:Fam205c UTSW 4 42871823 small deletion probably benign
R7785:Fam205c UTSW 4 42871823 small deletion probably benign
R7842:Fam205c UTSW 4 42871823 small deletion probably benign
RF040:Fam205c UTSW 4 42871823 small deletion probably benign
X0052:Fam205c UTSW 4 42874047 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- CCTTAAACGACATGCTTAGGCC -3'
(R):5'- CCTCATCTGGACACCGAATC -3'

Sequencing Primer
(F):5'- TAAACGACATGCTTAGGCCTGGTC -3'
(R):5'- CGAATCACCACTTGAGTTTATCCAAG -3'
Posted On2015-06-10