Incidental Mutation 'R7842:Fam205c'
ID606362
Institutional Source Beutler Lab
Gene Symbol Fam205c
Ensembl Gene ENSMUSG00000050141
Gene Namefamily with sequence similarity 205, member C
SynonymsBC049635
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R7842 (G1)
Quality Score140.461
Status Not validated
Chromosome4
Chromosomal Location42868004-42874234 bp(-) (GRCm38)
Type of Mutationsmall deletion (11 aa in frame mutation)
DNA Base Change (assembly) TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG to TCATTCAACACTTTGGAGAGCTCTGAACTCTGGCCATTCAACACTTTGGAGAGCTCTGAACTCTGGTCATTCAACACTTTGG at 42871823 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000103612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055944] [ENSMUST00000107978]
Predicted Effect probably benign
Transcript: ENSMUST00000055944
SMART Domains Protein: ENSMUSP00000060318
Gene: ENSMUSG00000050141

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DUF4599 51 139 2.7e-31 PFAM
internal_repeat_1 147 168 5.83e-10 PROSPERO
internal_repeat_1 180 201 5.83e-10 PROSPERO
low complexity region 278 289 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107978
SMART Domains Protein: ENSMUSP00000103612
Gene: ENSMUSG00000050141

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:DUF4599 52 138 3.4e-28 PFAM
internal_repeat_1 147 168 5.79e-10 PROSPERO
internal_repeat_1 180 201 5.79e-10 PROSPERO
low complexity region 278 289 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034J05Rik T C 6: 146,953,536 T3A unknown Het
4933412E24Rik T C 15: 60,016,573 E6G probably damaging Het
Abca6 A G 11: 110,196,697 L1135P possibly damaging Het
Agps A G 2: 75,851,532 D113G probably damaging Het
Ankhd1 G T 18: 36,647,828 V1978L probably benign Het
Ankrd31 T A 13: 96,821,458 probably null Het
Arhgap5 T A 12: 52,518,697 M817K possibly damaging Het
Bdp1 C A 13: 100,099,129 V105F probably damaging Het
Brdt A G 5: 107,348,588 N189D possibly damaging Het
Ccdc180 A T 4: 45,909,428 N532I probably benign Het
Ccnc A C 4: 21,730,480 K39T probably damaging Het
Cfap57 C A 4: 118,554,755 G1231* probably null Het
Chd7 A T 4: 8,854,115 T1896S probably benign Het
Clk4 A T 11: 51,281,129 H412L probably benign Het
Creld1 T C 6: 113,488,139 L109P probably damaging Het
Cxxc4 A T 3: 134,240,332 I225L possibly damaging Het
Cyp4f39 A T 17: 32,483,317 R263W probably benign Het
Dip2c T C 13: 9,606,533 probably null Het
Dnah14 A G 1: 181,627,898 T863A probably damaging Het
Dnah17 C A 11: 118,079,682 probably null Het
Dnajc10 A G 2: 80,345,065 K599E probably benign Het
Dnajc7 C A 11: 100,598,718 R101L probably benign Het
Dnttip2 G A 3: 122,276,341 E402K probably benign Het
Dusp22 T A 13: 30,668,791 probably null Het
Egflam C A 15: 7,251,194 R450M probably null Het
Eml5 C T 12: 98,794,135 R1785Q probably damaging Het
Fam45a G A 19: 60,830,879 A263T not run Het
Fam78b G T 1: 167,001,609 R15L probably damaging Het
Fbxl5 A T 5: 43,758,603 I489N probably damaging Het
Flt3 G A 5: 147,334,453 P893S probably damaging Het
Gm17019 T C 5: 15,031,035 M131V possibly damaging Het
Gm21560 T A 14: 6,216,262 I194F probably benign Het
Gm28729 T C 9: 96,517,652 D158G probably damaging Het
Gucy2c C T 6: 136,769,816 probably null Het
Hectd1 C T 12: 51,772,560 G1247S probably damaging Het
Ireb2 T A 9: 54,909,686 I946K probably benign Het
Itgb4 A T 11: 115,982,705 D249V probably benign Het
Klhdc7a A G 4: 139,967,238 S133P probably damaging Het
Lsr A T 7: 30,966,012 D172E possibly damaging Het
Macf1 T C 4: 123,526,909 E184G probably benign Het
Map2 T A 1: 66,416,411 D1421E probably benign Het
Map3k4 A T 17: 12,271,143 L467H possibly damaging Het
Mogat1 T C 1: 78,522,865 probably null Het
Mxra8 A G 4: 155,842,910 D384G probably damaging Het
Myo15b A G 11: 115,871,495 T1214A Het
Naip1 T C 13: 100,426,998 Y553C probably damaging Het
Nln A T 13: 104,052,629 I278K probably benign Het
Nsmaf T A 4: 6,435,109 probably null Het
Nynrin A G 14: 55,865,096 R741G probably damaging Het
Olfr1045 G T 2: 86,198,172 Y193* probably null Het
Olfr1166 C T 2: 88,124,986 probably benign Het
Olfr1208 A G 2: 88,896,961 V212A possibly damaging Het
Olfr603 A G 7: 103,383,576 V142A probably benign Het
Orc1 A G 4: 108,605,547 H607R probably benign Het
Pate2 A T 9: 35,670,533 Y41F probably damaging Het
Pcdhb20 A T 18: 37,505,059 T213S possibly damaging Het
Pcm1 G A 8: 41,327,584 E1858K possibly damaging Het
Pla2g2d A G 4: 138,778,778 T59A probably damaging Het
Ppl C T 16: 5,088,861 R1190H probably damaging Het
Prl2c2 A G 13: 13,005,322 L2P probably benign Het
Proz G A 8: 13,063,406 V76I probably benign Het
Prr36 A G 8: 4,210,953 S955P probably benign Het
Pter T C 2: 12,978,541 V119A probably damaging Het
Qrich1 T A 9: 108,556,368 probably null Het
Rbm15b T C 9: 106,885,889 E360G probably damaging Het
Skint11 G A 4: 114,244,771 C327Y possibly damaging Het
Spag17 T A 3: 100,053,858 S987T probably benign Het
Tbx1 T C 16: 18,586,615 S100G unknown Het
Tiam2 C T 17: 3,518,124 S1515L possibly damaging Het
Togaram1 C A 12: 64,966,459 D161E probably damaging Het
Trhde A T 10: 114,696,098 S366T possibly damaging Het
Ttc12 A G 9: 49,438,424 I691T possibly damaging Het
Ube4a A G 9: 44,949,727 probably null Het
Uggt2 A T 14: 118,998,104 I1453N probably damaging Het
Unc79 T C 12: 103,092,054 S972P probably damaging Het
Wdr20 G A 12: 110,738,215 D63N probably benign Het
Wdr66 T C 5: 123,254,424 V207A unknown Het
Wls T A 3: 159,873,179 I126N probably benign Het
Xirp2 A G 2: 67,524,945 D3350G probably benign Het
Other mutations in Fam205c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Fam205c APN 4 42868564 missense probably benign 0.40
IGL01697:Fam205c APN 4 42874163 missense probably benign
IGL02413:Fam205c APN 4 42868549 missense probably damaging 0.99
IGL02450:Fam205c APN 4 42874127 missense probably benign
R0433:Fam205c UTSW 4 42874013 splice site probably benign
R1580:Fam205c UTSW 4 42874020 splice site probably null
R2042:Fam205c UTSW 4 42874030 missense possibly damaging 0.96
R2102:Fam205c UTSW 4 42868558 missense probably benign 0.00
R3824:Fam205c UTSW 4 42873492 critical splice donor site probably null
R4192:Fam205c UTSW 4 42874185 utr 5 prime probably benign
R4668:Fam205c UTSW 4 42871608 missense probably benign 0.00
R4690:Fam205c UTSW 4 42873032 splice site probably null
R5743:Fam205c UTSW 4 42873087 missense probably damaging 0.99
R5868:Fam205c UTSW 4 42871711 missense probably damaging 0.96
R6186:Fam205c UTSW 4 42872000 missense possibly damaging 0.95
R6778:Fam205c UTSW 4 42868522 missense possibly damaging 0.94
R6986:Fam205c UTSW 4 42868696 missense possibly damaging 0.90
R7318:Fam205c UTSW 4 42871823 small deletion probably benign
R7413:Fam205c UTSW 4 42871823 small deletion probably benign
R7675:Fam205c UTSW 4 42871823 small deletion probably benign
R7785:Fam205c UTSW 4 42871823 small deletion probably benign
R8125:Fam205c UTSW 4 42873051 missense probably damaging 0.99
RF040:Fam205c UTSW 4 42871823 small deletion probably benign
X0052:Fam205c UTSW 4 42874047 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- CATCCTGGAACGCATTTGACC -3'
(R):5'- ACCTCTTCCAGTCTACTGAGGC -3'

Sequencing Primer
(F):5'- AACGCATTTGACCCTTGAGG -3'
(R):5'- GGCACTCCCGCAGCTTTTC -3'
Posted On2019-12-20