Incidental Mutation 'R6227:Lactbl1'
ID504392
Institutional Source Beutler Lab
Gene Symbol Lactbl1
Ensembl Gene ENSMUSG00000070683
Gene Namelactamase, beta-like 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.123) question?
Stock #R6227 (G1)
Quality Score134.008
Status Validated
Chromosome4
Chromosomal Location136622621-136639110 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 136637918 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 527 (A527E)
Ref Sequence ENSEMBL: ENSMUSP00000138455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178843]
Predicted Effect probably benign
Transcript: ENSMUST00000178843
AA Change: A527E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000138455
Gene: ENSMUSG00000070683
AA Change: A527E

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Beta-lactamase 87 440 3e-42 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195460
Meta Mutation Damage Score 0.0592 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.4%
Validation Efficiency 97% (61/63)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik T C 2: 19,553,770 probably null Het
Abca4 T A 3: 122,137,094 Y205* probably null Het
Adgrf1 A G 17: 43,310,273 D467G probably benign Het
Atp7b T C 8: 22,020,825 D550G possibly damaging Het
Bicd1 T A 6: 149,513,176 Y462* probably null Het
Cfap97 T C 8: 46,191,732 probably null Het
Csf1r T A 18: 61,125,828 Y706* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dst A G 1: 34,194,540 D3443G probably benign Het
Fktn C T 4: 53,731,136 A96V probably benign Het
Inppl1 G A 7: 101,824,299 T1048M possibly damaging Het
Itga2 T C 13: 114,839,561 T1092A probably benign Het
Miga1 C T 3: 152,278,949 A510T probably benign Het
Mip T A 10: 128,226,006 L42* probably null Het
Naca T G 10: 128,043,916 probably benign Het
Olfr561 A T 7: 102,774,676 I51F probably damaging Het
Olfr685 T C 7: 105,180,710 Y216C probably damaging Het
Olfr816 T A 10: 129,911,667 T204S probably damaging Het
Pcm1 T A 8: 41,330,825 M1986K probably damaging Het
Pex6 T A 17: 46,712,108 D203E probably benign Het
Rlbp1 T C 7: 79,380,128 N119S probably benign Het
Rptn C G 3: 93,398,130 H923Q possibly damaging Het
Rusc1 T A 3: 89,091,741 T245S probably benign Het
Slc26a5 A T 5: 21,821,097 C378S probably damaging Het
Smtn A G 11: 3,527,624 probably benign Het
Tes3-ps T C 13: 49,494,040 C131R probably damaging Het
Thbs4 T C 13: 92,774,682 E331G probably null Het
Tlr4 T C 4: 66,840,595 Y542H probably benign Het
Trf G A 9: 103,230,305 probably benign Het
Trim75 T A 8: 64,983,096 H234L probably benign Het
Zan T G 5: 137,468,343 R417S probably damaging Het
Zfp213 T C 17: 23,558,022 T349A probably benign Het
Zfp709 TCGACG TCG 8: 71,890,708 probably benign Het
Other mutations in Lactbl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Lactbl1 APN 4 136631051 missense probably damaging 1.00
R1592:Lactbl1 UTSW 4 136635876 splice site probably null
R2869:Lactbl1 UTSW 4 136626786 missense probably damaging 1.00
R2869:Lactbl1 UTSW 4 136626786 missense probably damaging 1.00
R2874:Lactbl1 UTSW 4 136626786 missense probably damaging 1.00
R3844:Lactbl1 UTSW 4 136637960 missense possibly damaging 0.91
R4375:Lactbl1 UTSW 4 136637591 missense possibly damaging 0.90
R5185:Lactbl1 UTSW 4 136631045 missense probably benign 0.00
R6544:Lactbl1 UTSW 4 136632989 missense possibly damaging 0.69
R7028:Lactbl1 UTSW 4 136632975 missense probably damaging 1.00
R7476:Lactbl1 UTSW 4 136637639 missense probably benign 0.01
R7779:Lactbl1 UTSW 4 136630996 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTAGTGAAACCGGTACACCC -3'
(R):5'- TCACTGGGAGCTGAACACTG -3'

Sequencing Primer
(F):5'- TACACCCTGGGAGTTCCAC -3'
(R):5'- AGCTGAACACTGGCCTGC -3'
Posted On2018-02-28