Incidental Mutation 'R6260:Gpam'
ID506668
Institutional Source Beutler Lab
Gene Symbol Gpam
Ensembl Gene ENSMUSG00000024978
Gene Nameglycerol-3-phosphate acyltransferase, mitochondrial
SynonymsGPAT1
MMRRC Submission 044377-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R6260 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location55069734-55099451 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55083406 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 301 (V301A)
Ref Sequence ENSEMBL: ENSMUSP00000057635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061856]
Predicted Effect probably benign
Transcript: ENSMUST00000061856
AA Change: V301A

PolyPhen 2 Score 0.401 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000057635
Gene: ENSMUSG00000024978
AA Change: V301A

DomainStartEndE-ValueType
Blast:PlsC 5 34 3e-8 BLAST
PlsC 224 357 2.46e-23 SMART
Blast:PlsC 499 551 8e-27 BLAST
low complexity region 687 699 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial enzyme which prefers saturated fatty acids as its substrate for the synthesis of glycerolipids. This metabolic pathway's first step is catalyzed by the encoded enzyme. Two forms for this enzyme exist, one in the mitochondria and one in the endoplasmic reticulum. Two alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous mutant mice weighed less than controls and showed reduced triacylglycerol levels in the liver and plasma. The glycerolipid fatty acid composition is also disrupted in mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T A 10: 80,008,987 N1514K probably damaging Het
Abcb4 G T 5: 8,934,219 G650* probably null Het
Acsbg1 T A 9: 54,628,467 probably null Het
Alms1 A T 6: 85,628,735 K2456* probably null Het
Alppl2 A T 1: 87,088,462 M225K probably damaging Het
Ank2 C T 3: 126,943,557 V2806I probably benign Het
Atxn10 A T 15: 85,462,411 I457F probably benign Het
Cad G T 5: 31,066,800 M800I probably null Het
Carmil3 T A 14: 55,500,432 L815Q probably damaging Het
Ccz1 A G 5: 144,004,041 probably null Het
Cdc73 G A 1: 143,691,473 T104I probably benign Het
Cfap52 A T 11: 67,938,954 C330S possibly damaging Het
Clec16a C T 16: 10,694,848 probably benign Het
Cntn3 A G 6: 102,277,217 probably null Het
Crocc2 A G 1: 93,213,638 K1171R possibly damaging Het
Ctsa T C 2: 164,834,361 V86A probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Ddhd2 A G 8: 25,752,117 F244L probably benign Het
Ddn A G 15: 98,805,854 V519A possibly damaging Het
Dip2b G T 15: 100,162,702 V253L probably benign Het
Dnah17 C A 11: 118,126,322 W197C probably damaging Het
Dnah17 C T 11: 118,126,323 W197* probably null Het
Dnah17 A T 11: 118,126,324 W197R probably damaging Het
Ercc6 T A 14: 32,557,856 D609E probably benign Het
Erg C A 16: 95,380,241 R147L probably damaging Het
Fbxo41 A T 6: 85,478,555 L549H probably damaging Het
Foxd4 A G 19: 24,899,604 S411P probably benign Het
Gaa C A 11: 119,281,171 A700D probably benign Het
Galntl6 T A 8: 57,884,481 D135V probably damaging Het
Gm1043 G C 5: 37,174,472 G832A probably benign Het
Gm14085 A T 2: 122,523,482 I530F probably damaging Het
Gm21103 C T 14: 6,303,847 E68K probably damaging Het
Gm340 A T 19: 41,582,370 S1C probably null Het
Gm340 G T 19: 41,582,371 S1I possibly damaging Het
H2-M10.1 T A 17: 36,324,102 I304F unknown Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Jak3 C A 8: 71,679,310 Q177K probably benign Het
Kcnu1 G A 8: 25,851,891 R88H probably damaging Het
Kng1 A T 16: 23,058,621 I60F possibly damaging Het
Krt77 A T 15: 101,864,372 Y257* probably null Het
Lgr6 C T 1: 134,994,010 A199T probably damaging Het
Map4k5 C A 12: 69,831,562 R355L probably benign Het
Mefv C T 16: 3,713,034 R498H probably benign Het
Mical3 A T 6: 121,009,030 L150Q probably damaging Het
Mtcl1 T A 17: 66,343,541 Q1340L probably damaging Het
Nfic A T 10: 81,420,517 C126* probably null Het
Nisch T A 14: 31,177,128 probably benign Het
Nt5dc3 A G 10: 86,811,531 Y130C probably damaging Het
Olfr1309 C T 2: 111,984,051 V8I probably benign Het
Olfr694 A T 7: 106,688,872 N286K probably damaging Het
Olfr808 C A 10: 129,767,520 T8K probably benign Het
Pcdhb12 T C 18: 37,436,839 V346A probably benign Het
Pla2g4a A G 1: 149,857,487 S504P probably benign Het
Plin2 G T 4: 86,657,289 A341D probably damaging Het
Plxnb2 A T 15: 89,165,291 I575N probably benign Het
Pnmal2 T G 7: 16,946,233 W381G probably benign Het
Psma8 A G 18: 14,721,267 D68G probably damaging Het
Rcor3 G A 1: 192,124,259 H207Y probably benign Het
Rwdd2b C A 16: 87,434,468 G266V probably damaging Het
Ryr3 A G 2: 112,660,104 F3795S probably damaging Het
Sord T A 2: 122,259,132 probably null Het
Spdl1 T A 11: 34,819,886 N345I probably damaging Het
St8sia2 T A 7: 73,976,693 R42S possibly damaging Het
Syt9 G T 7: 107,436,510 V245F possibly damaging Het
Tbpl2 T A 2: 24,094,886 N82I possibly damaging Het
Tcerg1 T A 18: 42,553,465 Y696N probably damaging Het
Thsd7b A G 1: 129,667,918 T492A probably benign Het
Timm13 A C 10: 80,900,301 probably benign Het
Trdmt1 T A 2: 13,520,059 Q195L probably benign Het
Ttc27 T A 17: 74,858,091 V764D probably damaging Het
Ttc39d C A 17: 80,216,647 S245* probably null Het
Ttc41 A G 10: 86,731,159 E563G probably benign Het
Ttc41 A T 10: 86,733,707 T650S probably benign Het
U2surp A C 9: 95,476,157 L723R probably damaging Het
Ubqln3 G A 7: 104,142,317 Q189* probably null Het
Vezf1 A G 11: 88,081,500 N229S probably damaging Het
Vmn2r79 T A 7: 87,037,157 M582K probably benign Het
Zfp518a A G 19: 40,914,123 D832G probably benign Het
Zfyve28 T C 5: 34,198,872 N762D probably damaging Het
Other mutations in Gpam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Gpam APN 19 55078332 missense possibly damaging 0.71
IGL01349:Gpam APN 19 55096119 critical splice donor site probably null
IGL01515:Gpam APN 19 55087451 missense probably damaging 1.00
IGL01650:Gpam APN 19 55081700 missense probably benign 0.02
IGL01768:Gpam APN 19 55087520 missense probably benign 0.00
IGL01809:Gpam APN 19 55075625 nonsense probably null
IGL01878:Gpam APN 19 55083374 missense probably benign 0.22
IGL02451:Gpam APN 19 55088203 missense probably damaging 1.00
IGL03293:Gpam APN 19 55071016 missense probably benign
IGL03391:Gpam APN 19 55081696 missense probably damaging 1.00
R0492:Gpam UTSW 19 55096179 missense possibly damaging 0.72
R0703:Gpam UTSW 19 55072756 missense probably benign 0.00
R1083:Gpam UTSW 19 55088211 splice site probably benign
R1432:Gpam UTSW 19 55079261 missense probably damaging 0.99
R1457:Gpam UTSW 19 55088176 missense probably damaging 1.00
R1556:Gpam UTSW 19 55076331 missense possibly damaging 0.94
R1733:Gpam UTSW 19 55081469 missense probably damaging 0.99
R1744:Gpam UTSW 19 55074591 missense probably damaging 1.00
R1776:Gpam UTSW 19 55078575 missense possibly damaging 0.88
R2267:Gpam UTSW 19 55072710 critical splice donor site probably null
R2697:Gpam UTSW 19 55083209 missense probably damaging 1.00
R3836:Gpam UTSW 19 55080458 missense probably benign
R3837:Gpam UTSW 19 55080458 missense probably benign
R3838:Gpam UTSW 19 55080458 missense probably benign
R3839:Gpam UTSW 19 55080458 missense probably benign
R4670:Gpam UTSW 19 55096119 critical splice donor site probably null
R4717:Gpam UTSW 19 55075614 missense probably benign 0.00
R4819:Gpam UTSW 19 55078341 missense probably benign 0.03
R5104:Gpam UTSW 19 55093986 missense probably benign 0.44
R5146:Gpam UTSW 19 55093946 missense probably damaging 1.00
R5183:Gpam UTSW 19 55083227 missense probably damaging 1.00
R5326:Gpam UTSW 19 55091165 missense probably benign 0.05
R5347:Gpam UTSW 19 55088837 missense probably damaging 1.00
R5621:Gpam UTSW 19 55079260 missense probably damaging 1.00
R5644:Gpam UTSW 19 55088899 missense probably benign 0.00
R6244:Gpam UTSW 19 55070985 missense probably damaging 1.00
R6965:Gpam UTSW 19 55074609 missense probably damaging 1.00
R7125:Gpam UTSW 19 55076335 missense probably benign
R7567:Gpam UTSW 19 55081630 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ATCATACGAGATGCCCACGG -3'
(R):5'- ACGGAGACATGATGGGTTTG -3'

Sequencing Primer
(F):5'- TACGAGATGCCCACGGGTATG -3'
(R):5'- TGTGTGTGATCACCCAAGCAC -3'
Posted On2018-03-15