Mutagenetix > Incidental Mutation

Incidental Mutation 'R6260:Pla2g4a'

506598

Institutional Source

Beutler Lab

Gene Symbol

Pla2g4a

Ensembl Gene

ENSMUSG00000056220

Gene Name

phospholipase A2, group IVA (cytosolic, calcium-dependent)

Synonyms

Type IV PLA2, cytosolic phospholipase A2, Pla2g4, cytosolic PLA2, cPLA2alpha, cPLA2

MMRRC Submission

044377-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.189) question?

Stock #

R6260 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

149829618-149961290 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 149857487 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 504 (S504P)

Ref Sequence

ENSEMBL: ENSMUSP00000107557 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000070200] [ENSMUST00000111926]

AlphaFold

P47713

Predicted Effect

probably benign
Transcript: ENSMUST00000070200
AA Change: S512P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000070868
Gene: ENSMUSG00000056220
AA Change: S512P

Domain	Start	End	E-Value	Type
C2	19	121	8.23e-17	SMART
PLAc	117	668	N/A	SMART
Blast:PLAc	706	748	3e-10	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000111926
AA Change: S504P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000107557
Gene: ENSMUSG00000056220
AA Change: S504P

Domain	Start	End	E-Value	Type
C2	11	113	8.23e-17	SMART
PLAc	109	660	N/A	SMART
Blast:PLAc	698	740	3e-10	BLAST

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: The protein encoded by this gene is a member of the phospholipase A2 group IV family. This enzyme hydrolyzes membrane phospholipids, thereby releasing the polyunsaturated fatty acid, arachidonic acid. Arachidonic acid is further metabolized into eicosanoids such as leukotrienes, thromboxanes and prostaglandins, that play important roles in regulating diverse biological processes such as inflammatory responses, membrane and actin dynamics, and tumorigenesis. A rise in intracellular calcium levels results in binding of calcium to the C2 domain of this protein, and triggers the translocation from the cytosol to intracellular membranes, including the Golgi apparatus. Disruption of this gene in mice led to decreased levels of eicosonaoids and platelet-activating factor, decreased allergic symptoms, and impaired reproductive ability in females. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygouse for disruptions in this gene display reduced allergic and autoimmune reactions. They also display an increased incidence of insulin and reduced female reproductive performance. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca7	T	A	10: 80,008,987	N1514K	probably damaging	Het
Abcb4	G	T	5: 8,934,219	G650*	probably null	Het
Acsbg1	T	A	9: 54,628,467		probably null	Het
Alms1	A	T	6: 85,628,735	K2456*	probably null	Het
Alppl2	A	T	1: 87,088,462	M225K	probably damaging	Het
Ank2	C	T	3: 126,943,557	V2806I	probably benign	Het
Atxn10	A	T	15: 85,462,411	I457F	probably benign	Het
Cad	G	T	5: 31,066,800	M800I	probably null	Het
Carmil3	T	A	14: 55,500,432	L815Q	probably damaging	Het
Ccz1	A	G	5: 144,004,041		probably null	Het
Cdc73	G	A	1: 143,691,473	T104I	probably benign	Het
Cfap52	A	T	11: 67,938,954	C330S	possibly damaging	Het
Clec16a	C	T	16: 10,694,848		probably benign	Het
Cntn3	A	G	6: 102,277,217		probably null	Het
Crocc2	A	G	1: 93,213,638	K1171R	possibly damaging	Het
Ctsa	T	C	2: 164,834,361	V86A	probably damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Ddhd2	A	G	8: 25,752,117	F244L	probably benign	Het
Ddn	A	G	15: 98,805,854	V519A	possibly damaging	Het
Dip2b	G	T	15: 100,162,702	V253L	probably benign	Het
Dnah17	A	T	11: 118,126,324	W197R	probably damaging	Het
Dnah17	C	T	11: 118,126,323	W197*	probably null	Het
Dnah17	C	A	11: 118,126,322	W197C	probably damaging	Het
Ercc6	T	A	14: 32,557,856	D609E	probably benign	Het
Erg	C	A	16: 95,380,241	R147L	probably damaging	Het
Fbxo41	A	T	6: 85,478,555	L549H	probably damaging	Het
Foxd4	A	G	19: 24,899,604	S411P	probably benign	Het
Gaa	C	A	11: 119,281,171	A700D	probably benign	Het
Galntl6	T	A	8: 57,884,481	D135V	probably damaging	Het
Gm1043	G	C	5: 37,174,472	G832A	probably benign	Het
Gm14085	A	T	2: 122,523,482	I530F	probably damaging	Het
Gm21103	C	T	14: 6,303,847	E68K	probably damaging	Het
Gm340	A	T	19: 41,582,370	S1C	probably null	Het
Gm340	G	T	19: 41,582,371	S1I	possibly damaging	Het
Gpam	A	G	19: 55,083,406	V301A	probably benign	Het
H2-M10.1	T	A	17: 36,324,102	I304F	unknown	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Jak3	C	A	8: 71,679,310	Q177K	probably benign	Het
Kcnu1	G	A	8: 25,851,891	R88H	probably damaging	Het
Kng1	A	T	16: 23,058,621	I60F	possibly damaging	Het
Krt77	A	T	15: 101,864,372	Y257*	probably null	Het
Lgr6	C	T	1: 134,994,010	A199T	probably damaging	Het
Map4k5	C	A	12: 69,831,562	R355L	probably benign	Het
Mefv	C	T	16: 3,713,034	R498H	probably benign	Het
Mical3	A	T	6: 121,009,030	L150Q	probably damaging	Het
Mtcl1	T	A	17: 66,343,541	Q1340L	probably damaging	Het
Nfic	A	T	10: 81,420,517	C126*	probably null	Het
Nisch	T	A	14: 31,177,128		probably benign	Het
Nt5dc3	A	G	10: 86,811,531	Y130C	probably damaging	Het
Olfr1309	C	T	2: 111,984,051	V8I	probably benign	Het
Olfr694	A	T	7: 106,688,872	N286K	probably damaging	Het
Olfr808	C	A	10: 129,767,520	T8K	probably benign	Het
Pcdhb12	T	C	18: 37,436,839	V346A	probably benign	Het
Plin2	G	T	4: 86,657,289	A341D	probably damaging	Het
Plxnb2	A	T	15: 89,165,291	I575N	probably benign	Het
Pnmal2	T	G	7: 16,946,233	W381G	probably benign	Het
Psma8	A	G	18: 14,721,267	D68G	probably damaging	Het
Rcor3	G	A	1: 192,124,259	H207Y	probably benign	Het
Rwdd2b	C	A	16: 87,434,468	G266V	probably damaging	Het
Ryr3	A	G	2: 112,660,104	F3795S	probably damaging	Het
Sord	T	A	2: 122,259,132		probably null	Het
Spdl1	T	A	11: 34,819,886	N345I	probably damaging	Het
St8sia2	T	A	7: 73,976,693	R42S	possibly damaging	Het
Syt9	G	T	7: 107,436,510	V245F	possibly damaging	Het
Tbpl2	T	A	2: 24,094,886	N82I	possibly damaging	Het
Tcerg1	T	A	18: 42,553,465	Y696N	probably damaging	Het
Thsd7b	A	G	1: 129,667,918	T492A	probably benign	Het
Timm13	A	C	10: 80,900,301		probably benign	Het
Trdmt1	T	A	2: 13,520,059	Q195L	probably benign	Het
Ttc27	T	A	17: 74,858,091	V764D	probably damaging	Het
Ttc39d	C	A	17: 80,216,647	S245*	probably null	Het
Ttc41	A	G	10: 86,731,159	E563G	probably benign	Het
Ttc41	A	T	10: 86,733,707	T650S	probably benign	Het
U2surp	A	C	9: 95,476,157	L723R	probably damaging	Het
Ubqln3	G	A	7: 104,142,317	Q189*	probably null	Het
Vezf1	A	G	11: 88,081,500	N229S	probably damaging	Het
Vmn2r79	T	A	7: 87,037,157	M582K	probably benign	Het
Zfp518a	A	G	19: 40,914,123	D832G	probably benign	Het
Zfyve28	T	C	5: 34,198,872	N762D	probably damaging	Het

Other mutations in Pla2g4a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00660:Pla2g4a	APN	1	149886203	missense	probably benign	0.08
IGL00763:Pla2g4a	APN	1	149851325	missense	probably damaging	1.00
IGL01548:Pla2g4a	APN	1	149932656	critical splice donor site	probably null
IGL01683:Pla2g4a	APN	1	149857654	missense	probably benign	0.05
IGL01903:Pla2g4a	APN	1	149840619	missense	possibly damaging	0.51
IGL02049:Pla2g4a	APN	1	149861096	missense	probably benign	0.12
IGL02103:Pla2g4a	APN	1	149901199	missense	probably damaging	0.99
IGL03132:Pla2g4a	APN	1	149902284	splice site	probably benign
IGL03299:Pla2g4a	APN	1	149851367	missense	probably damaging	1.00
IGL03302:Pla2g4a	APN	1	149864947	missense	probably benign	0.00
R0110:Pla2g4a	UTSW	1	149840647	missense	possibly damaging	0.67
R0469:Pla2g4a	UTSW	1	149840647	missense	possibly damaging	0.67
R0488:Pla2g4a	UTSW	1	149871445	missense	probably damaging	1.00
R0606:Pla2g4a	UTSW	1	149840704	missense	probably benign	0.44
R1468:Pla2g4a	UTSW	1	149887593	splice site	probably benign
R1470:Pla2g4a	UTSW	1	149840720	missense	probably damaging	1.00
R1470:Pla2g4a	UTSW	1	149840720	missense	probably damaging	1.00
R1521:Pla2g4a	UTSW	1	149857686	critical splice acceptor site	probably null
R1718:Pla2g4a	UTSW	1	149871523	splice site	probably benign
R1778:Pla2g4a	UTSW	1	149902445	splice site	probably benign
R1967:Pla2g4a	UTSW	1	149922081	missense	probably damaging	1.00
R2063:Pla2g4a	UTSW	1	149840676	missense	possibly damaging	0.94
R2291:Pla2g4a	UTSW	1	149901189	missense	probably damaging	1.00
R3855:Pla2g4a	UTSW	1	149830177	missense	possibly damaging	0.86
R4512:Pla2g4a	UTSW	1	149861051	splice site	probably null
R4568:Pla2g4a	UTSW	1	149842226	missense	probably benign	0.43
R5266:Pla2g4a	UTSW	1	149865167	missense	possibly damaging	0.79
R5855:Pla2g4a	UTSW	1	149880063	missense	probably damaging	0.99
R5897:Pla2g4a	UTSW	1	149865148	missense	probably damaging	0.99
R6012:Pla2g4a	UTSW	1	149932677	missense	possibly damaging	0.55
R6193:Pla2g4a	UTSW	1	149902430	missense	probably damaging	1.00
R6246:Pla2g4a	UTSW	1	149872587	missense	probably damaging	1.00
R6248:Pla2g4a	UTSW	1	149872587	missense	probably damaging	1.00
R6258:Pla2g4a	UTSW	1	149857487	missense	probably benign	0.00
R6293:Pla2g4a	UTSW	1	149880047	missense	probably damaging	0.98
R6310:Pla2g4a	UTSW	1	149842226	missense	possibly damaging	0.88
R6490:Pla2g4a	UTSW	1	149851335	nonsense	probably null
R6502:Pla2g4a	UTSW	1	149872616	nonsense	probably null
R6614:Pla2g4a	UTSW	1	149842235	missense	probably benign	0.07
R6671:Pla2g4a	UTSW	1	149887631	missense	probably benign
R6745:Pla2g4a	UTSW	1	149886230	missense	probably benign	0.07
R6880:Pla2g4a	UTSW	1	149851451	missense	possibly damaging	0.90
R7058:Pla2g4a	UTSW	1	149851352	missense	probably damaging	1.00
R7163:Pla2g4a	UTSW	1	149840665	nonsense	probably null
R7422:Pla2g4a	UTSW	1	149932687	missense	probably benign	0.32
R7454:Pla2g4a	UTSW	1	149872690	missense	possibly damaging	0.63
R7474:Pla2g4a	UTSW	1	149865200	missense	possibly damaging	0.88
R7514:Pla2g4a	UTSW	1	149851362	missense	probably damaging	1.00
R7536:Pla2g4a	UTSW	1	149880017	missense	probably damaging	1.00
R7682:Pla2g4a	UTSW	1	149886271	missense	probably damaging	1.00
R7744:Pla2g4a	UTSW	1	149861102	missense	probably benign	0.06
R7766:Pla2g4a	UTSW	1	149861058	missense	probably benign	0.00
R7783:Pla2g4a	UTSW	1	149872744	missense	probably damaging	1.00
R8031:Pla2g4a	UTSW	1	149901213	missense	possibly damaging	0.87
R8145:Pla2g4a	UTSW	1	149840643	missense	probably benign	0.42
R8189:Pla2g4a	UTSW	1	149857586	missense	probably benign	0.04
R8252:Pla2g4a	UTSW	1	149851307	missense	probably damaging	1.00
R8315:Pla2g4a	UTSW	1	149886214	missense	probably benign	0.02
R8762:Pla2g4a	UTSW	1	149886184	missense	probably benign	0.00
R8783:Pla2g4a	UTSW	1	149864990	missense	probably damaging	1.00
R8838:Pla2g4a	UTSW	1	149871505	missense	probably benign	0.00
R9132:Pla2g4a	UTSW	1	149871479	missense	probably benign	0.01
R9282:Pla2g4a	UTSW	1	149871456	missense	probably damaging	1.00
R9412:Pla2g4a	UTSW	1	149880021	missense	probably damaging	0.99
X0021:Pla2g4a	UTSW	1	149864926	missense	possibly damaging	0.66
Z1177:Pla2g4a	UTSW	1	149871434	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTAGGCCATTACCTAACCAATG -3'
(R):5'- GGCACGTGTGTAAATATTTGGC -3'

Sequencing Primer
(F):5'- TTCAATAGTAGCAGTAGTAGTAGTGG -3'
(R):5'- CCTTCAGGCACCGAGAATG -3'

Posted On

2018-03-15