Incidental Mutation 'R6261:Cyp4a12b'
ID506688
Institutional Source Beutler Lab
Gene Symbol Cyp4a12b
Ensembl Gene ENSMUSG00000078597
Gene Namecytochrome P450, family 4, subfamily a, polypeptide 12B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R6261 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location115411624-115439034 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 115414543 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 150 (Y150*)
Ref Sequence ENSEMBL: ENSMUSP00000092487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094887]
Predicted Effect probably null
Transcript: ENSMUST00000094887
AA Change: Y150*
SMART Domains Protein: ENSMUSP00000092487
Gene: ENSMUSG00000078597
AA Change: Y150*

DomainStartEndE-ValueType
low complexity region 18 39 N/A INTRINSIC
Pfam:p450 51 503 1.9e-132 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120131
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.7%
  • 20x: 96.7%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot8 T C 2: 164,795,059 D257G probably damaging Het
Adamtsl1 T C 4: 86,336,878 V736A probably benign Het
Anln A G 9: 22,364,046 L521S probably damaging Het
Arfgap2 T G 2: 91,270,282 S311A probably benign Het
Brdt A T 5: 107,348,503 E160D probably benign Het
Ccdc187 A G 2: 26,276,203 I738T probably damaging Het
Cd59a G C 2: 104,104,205 G6A probably damaging Het
Cd5l C T 3: 87,368,608 P295L probably benign Het
Cnot1 A G 8: 95,741,921 S1432P probably benign Het
Cnot8 T A 11: 58,114,051 I192N probably damaging Het
Col4a1 G T 8: 11,207,409 probably null Het
Cuta A G 17: 26,939,327 L11P possibly damaging Het
Cyp2c39 G A 19: 39,568,019 R433H probably damaging Het
Dcaf15 G A 8: 84,099,105 A291V probably benign Het
Dcstamp A T 15: 39,754,735 H180L possibly damaging Het
Egfr A G 11: 16,889,964 I659M probably benign Het
Fzd8 A G 18: 9,214,598 E560G possibly damaging Het
Gm28710 T C 5: 16,812,185 noncoding transcript Het
Gm5111 A T 6: 48,589,592 probably benign Het
Gm7945 T C 14: 41,382,823 T214A unknown Het
Gpi1 T C 7: 34,220,745 T168A possibly damaging Het
Gys2 T C 6: 142,459,408 I218V probably benign Het
Gzmf T A 14: 56,206,492 I74L probably benign Het
Hacl1 G A 14: 31,635,771 A70V probably damaging Het
Herc2 T A 7: 56,197,072 L3590* probably null Het
Idh2 GGTCCCAG GG 7: 80,098,329 probably benign Het
Igfals G T 17: 24,881,365 V477F possibly damaging Het
Igkv8-28 A T 6: 70,143,890 V23E probably benign Het
Isg20l2 T A 3: 87,932,088 V202E probably damaging Het
Jakmip2 A G 18: 43,575,534 I288T probably benign Het
Kansl3 A G 1: 36,365,605 V88A probably benign Het
Kcna3 A G 3: 107,037,950 T510A possibly damaging Het
Map2k5 G T 9: 63,338,098 L140I probably benign Het
Map3k19 A G 1: 127,822,599 I1005T possibly damaging Het
Mmp25 G A 17: 23,630,794 A541V possibly damaging Het
Ms4a14 T A 19: 11,304,020 E391D probably benign Het
Mtrf1l A G 10: 5,815,550 probably null Het
Myom1 A G 17: 71,126,137 N1591S probably damaging Het
Nos1 G A 5: 117,936,570 V1060M probably benign Het
Nsun5 C T 5: 135,371,531 T142M probably damaging Het
Odc1 A G 12: 17,550,654 E430G probably benign Het
Olfr957 C A 9: 39,510,809 V304F probably benign Het
P2ry12 T C 3: 59,217,907 I116V probably null Het
Patl1 T A 19: 11,920,331 V94E probably damaging Het
Plin3 A T 17: 56,281,488 Y255* probably null Het
Pou6f1 T C 15: 100,579,946 T439A probably damaging Het
Prdm13 T C 4: 21,678,366 K708R probably damaging Het
Prr14l A G 5: 32,829,404 S916P possibly damaging Het
Rab34 T A 11: 78,191,202 probably null Het
Rps7 A G 12: 28,635,594 S21P possibly damaging Het
Scn9a A T 2: 66,483,896 L1815Q probably damaging Het
Sesn3 A G 9: 14,321,163 Y244C probably benign Het
Slc15a2 A G 16: 36,761,611 F284L probably benign Het
Slc25a44 C T 3: 88,420,911 G72D probably damaging Het
Slco6d1 A G 1: 98,499,863 T640A probably benign Het
Sspo A T 6: 48,462,191 E1591V possibly damaging Het
Tbata C A 10: 61,175,865 T60K possibly damaging Het
Tbc1d2 T A 4: 46,637,692 T185S possibly damaging Het
Tmem56 T A 3: 121,235,059 I60F possibly damaging Het
Tmem87a A G 2: 120,404,021 S14P possibly damaging Het
Tnnt2 C A 1: 135,850,554 probably null Het
Trex1 A G 9: 109,058,641 V94A probably benign Het
Ubtfl1 A C 9: 18,409,296 D40A possibly damaging Het
Zc3hav1 A T 6: 38,333,000 Y296N probably benign Het
Zfp521 T A 18: 13,844,627 N910Y probably damaging Het
Zfp53 A G 17: 21,508,713 E336G possibly damaging Het
Other mutations in Cyp4a12b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Cyp4a12b APN 4 115438049 splice site probably null
IGL01571:Cyp4a12b APN 4 115438157 missense probably benign 0.00
IGL02230:Cyp4a12b APN 4 115433996 missense probably damaging 1.00
IGL02720:Cyp4a12b APN 4 115435171 splice site probably benign
IGL03118:Cyp4a12b APN 4 115432976 missense possibly damaging 0.54
IGL03389:Cyp4a12b APN 4 115433808 missense possibly damaging 0.90
R0360:Cyp4a12b UTSW 4 115432920 missense probably benign 0.01
R0364:Cyp4a12b UTSW 4 115432920 missense probably benign 0.01
R0844:Cyp4a12b UTSW 4 115432524 missense possibly damaging 0.67
R1226:Cyp4a12b UTSW 4 115432967 missense possibly damaging 0.80
R1232:Cyp4a12b UTSW 4 115432563 missense possibly damaging 0.81
R1372:Cyp4a12b UTSW 4 115432949 missense probably benign 0.08
R1559:Cyp4a12b UTSW 4 115433984 missense probably damaging 0.98
R1782:Cyp4a12b UTSW 4 115433981 missense probably damaging 1.00
R1817:Cyp4a12b UTSW 4 115414062 splice site probably benign
R1941:Cyp4a12b UTSW 4 115438059 missense probably damaging 1.00
R1978:Cyp4a12b UTSW 4 115438145 missense probably benign 0.01
R2063:Cyp4a12b UTSW 4 115433503 missense possibly damaging 0.87
R2109:Cyp4a12b UTSW 4 115432913 missense probably damaging 0.97
R2911:Cyp4a12b UTSW 4 115433526 nonsense probably null
R3791:Cyp4a12b UTSW 4 115434970 missense probably benign 0.01
R3815:Cyp4a12b UTSW 4 115432470 missense probably damaging 0.98
R3816:Cyp4a12b UTSW 4 115432470 missense probably damaging 0.98
R3817:Cyp4a12b UTSW 4 115432470 missense probably damaging 0.98
R3818:Cyp4a12b UTSW 4 115432470 missense probably damaging 0.98
R4586:Cyp4a12b UTSW 4 115432506 missense probably damaging 1.00
R5004:Cyp4a12b UTSW 4 115438113 missense probably benign 0.39
R5105:Cyp4a12b UTSW 4 115433761 missense probably damaging 1.00
R5354:Cyp4a12b UTSW 4 115433464 splice site probably null
R5655:Cyp4a12b UTSW 4 115433797 missense probably damaging 1.00
R5814:Cyp4a12b UTSW 4 115432497 missense probably damaging 0.97
R5952:Cyp4a12b UTSW 4 115414517 nonsense probably null
R6004:Cyp4a12b UTSW 4 115433467 missense probably benign 0.35
R6059:Cyp4a12b UTSW 4 115438104 missense possibly damaging 0.94
R7484:Cyp4a12b UTSW 4 115432563 missense possibly damaging 0.81
R7734:Cyp4a12b UTSW 4 115411740 missense possibly damaging 0.89
RF045:Cyp4a12b UTSW 4 115432493 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TGTCTCATCATATGTACCAGGCC -3'
(R):5'- TGGCATTGACTTTTGTGGAACC -3'

Sequencing Primer
(F):5'- GTGTTGAAAAATATTAGGCTTTTCCC -3'
(R):5'- GCATTGACTTTTGTGGAACCTATTTC -3'
Posted On2018-03-15