Mutagenetix > Incidental Mutations

Incidental Mutation 'R6261:Gys2'

506697

Institutional Source

Beutler Lab

Gene Symbol

Gys2

Ensembl Gene

ENSMUSG00000030244

Gene Name

glycogen synthase 2

Synonyms

glycogen synthase, liver, LGS

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.259) question?

Stock #

R6261 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

142422613-142473109 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 142459408 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 218 (I218V)

Ref Sequence

ENSEMBL: ENSMUSP00000032371 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032371]

Predicted Effect

probably benign
Transcript: ENSMUST00000032371
AA Change: I218V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000032371
Gene: ENSMUSG00000030244
AA Change: I218V

Domain	Start	End	E-Value	Type
Pfam:Glycogen_syn	32	667	N/A	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.7%
20x: 96.7%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene, liver glycogen synthase, catalyzes the rate-limiting step in the synthesis of glycogen - the transfer of a glucose molecule from UDP-glucose to a terminal branch of the glycogen molecule. Mutations in this gene cause glycogen storage disease type 0 (GSD-0) - a rare type of early childhood fasting hypoglycemia with decreased liver glycogen content. [provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for a conditional allele knocked out in the liver results in abnormal glycogen homeostasis, altered glucose homeostasis, decreased exercise endurance, and a phenotype similar to patients with glycogen storage disease 0. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acot8	T	C	2: 164,795,059	D257G	probably damaging	Het
Adamtsl1	T	C	4: 86,336,878	V736A	probably benign	Het
Anln	A	G	9: 22,364,046	L521S	probably damaging	Het
Arfgap2	T	G	2: 91,270,282	S311A	probably benign	Het
Brdt	A	T	5: 107,348,503	E160D	probably benign	Het
Ccdc187	A	G	2: 26,276,203	I738T	probably damaging	Het
Cd59a	G	C	2: 104,104,205	G6A	probably damaging	Het
Cd5l	C	T	3: 87,368,608	P295L	probably benign	Het
Cnot1	A	G	8: 95,741,921	S1432P	probably benign	Het
Cnot8	T	A	11: 58,114,051	I192N	probably damaging	Het
Col4a1	G	T	8: 11,207,409		probably null	Het
Cuta	A	G	17: 26,939,327	L11P	possibly damaging	Het
Cyp2c39	G	A	19: 39,568,019	R433H	probably damaging	Het
Cyp4a12b	T	A	4: 115,414,543	Y150*	probably null	Het
Dcaf15	G	A	8: 84,099,105	A291V	probably benign	Het
Dcstamp	A	T	15: 39,754,735	H180L	possibly damaging	Het
Egfr	A	G	11: 16,889,964	I659M	probably benign	Het
Fzd8	A	G	18: 9,214,598	E560G	possibly damaging	Het
Gm28710	T	C	5: 16,812,185		noncoding transcript	Het
Gm5111	A	T	6: 48,589,592		probably benign	Het
Gm7945	T	C	14: 41,382,823	T214A	unknown	Het
Gpi1	T	C	7: 34,220,745	T168A	possibly damaging	Het
Gzmf	T	A	14: 56,206,492	I74L	probably benign	Het
Hacl1	G	A	14: 31,635,771	A70V	probably damaging	Het
Herc2	T	A	7: 56,197,072	L3590*	probably null	Het
Idh2	GGTCCCAG	GG	7: 80,098,329		probably benign	Het
Igfals	G	T	17: 24,881,365	V477F	possibly damaging	Het
Igkv8-28	A	T	6: 70,143,890	V23E	probably benign	Het
Isg20l2	T	A	3: 87,932,088	V202E	probably damaging	Het
Jakmip2	A	G	18: 43,575,534	I288T	probably benign	Het
Kansl3	A	G	1: 36,365,605	V88A	probably benign	Het
Kcna3	A	G	3: 107,037,950	T510A	possibly damaging	Het
Map2k5	G	T	9: 63,338,098	L140I	probably benign	Het
Map3k19	A	G	1: 127,822,599	I1005T	possibly damaging	Het
Mmp25	G	A	17: 23,630,794	A541V	possibly damaging	Het
Ms4a14	T	A	19: 11,304,020	E391D	probably benign	Het
Mtrf1l	A	G	10: 5,815,550		probably null	Het
Myom1	A	G	17: 71,126,137	N1591S	probably damaging	Het
Nos1	G	A	5: 117,936,570	V1060M	probably benign	Het
Nsun5	C	T	5: 135,371,531	T142M	probably damaging	Het
Odc1	A	G	12: 17,550,654	E430G	probably benign	Het
Olfr957	C	A	9: 39,510,809	V304F	probably benign	Het
P2ry12	T	C	3: 59,217,907	I116V	probably null	Het
Patl1	T	A	19: 11,920,331	V94E	probably damaging	Het
Plin3	A	T	17: 56,281,488	Y255*	probably null	Het
Pou6f1	T	C	15: 100,579,946	T439A	probably damaging	Het
Prdm13	T	C	4: 21,678,366	K708R	probably damaging	Het
Prr14l	A	G	5: 32,829,404	S916P	possibly damaging	Het
Rab34	T	A	11: 78,191,202		probably null	Het
Rps7	A	G	12: 28,635,594	S21P	possibly damaging	Het
Scn9a	A	T	2: 66,483,896	L1815Q	probably damaging	Het
Sesn3	A	G	9: 14,321,163	Y244C	probably benign	Het
Slc15a2	A	G	16: 36,761,611	F284L	probably benign	Het
Slc25a44	C	T	3: 88,420,911	G72D	probably damaging	Het
Slco6d1	A	G	1: 98,499,863	T640A	probably benign	Het
Sspo	A	T	6: 48,462,191	E1591V	possibly damaging	Het
Tbata	C	A	10: 61,175,865	T60K	possibly damaging	Het
Tbc1d2	T	A	4: 46,637,692	T185S	possibly damaging	Het
Tmem56	T	A	3: 121,235,059	I60F	possibly damaging	Het
Tmem87a	A	G	2: 120,404,021	S14P	possibly damaging	Het
Tnnt2	C	A	1: 135,850,554		probably null	Het
Trex1	A	G	9: 109,058,641	V94A	probably benign	Het
Ubtfl1	A	C	9: 18,409,296	D40A	possibly damaging	Het
Zc3hav1	A	T	6: 38,333,000	Y296N	probably benign	Het
Zfp521	T	A	18: 13,844,627	N910Y	probably damaging	Het
Zfp53	A	G	17: 21,508,713	E336G	possibly damaging	Het

Other mutations in Gys2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00466:Gys2	APN	6	142463290	nonsense	probably null
IGL02963:Gys2	APN	6	142449428	critical splice donor site	probably null
IGL02997:Gys2	APN	6	142449469	missense	probably damaging	1.00
candy_corn	UTSW	6	142456333	missense	probably benign	0.00
embittered	UTSW	6	142454484	missense	possibly damaging	0.92
hazelnut	UTSW	6	142449455	missense	possibly damaging	0.67
R0243:Gys2	UTSW	6	142472668	splice site	probably benign
R1124:Gys2	UTSW	6	142446013	missense	probably damaging	0.97
R1188:Gys2	UTSW	6	142455183	missense	probably damaging	1.00
R1208:Gys2	UTSW	6	142450467	critical splice donor site	probably null
R1208:Gys2	UTSW	6	142450467	critical splice donor site	probably null
R1235:Gys2	UTSW	6	142430293	missense	probably damaging	1.00
R1387:Gys2	UTSW	6	142461283	missense	probably benign	0.06
R1758:Gys2	UTSW	6	142472706	missense	probably damaging	1.00
R1819:Gys2	UTSW	6	142461186	missense	probably damaging	1.00
R2221:Gys2	UTSW	6	142456422	missense	probably damaging	1.00
R2311:Gys2	UTSW	6	142463244	missense	possibly damaging	0.81
R2344:Gys2	UTSW	6	142446022	missense	probably damaging	0.99
R3151:Gys2	UTSW	6	142456333	missense	probably benign	0.00
R3902:Gys2	UTSW	6	142472800	start codon destroyed	probably null	0.98
R4532:Gys2	UTSW	6	142455141	missense	probably damaging	0.98
R4577:Gys2	UTSW	6	142454510	missense	possibly damaging	0.93
R4588:Gys2	UTSW	6	142449455	missense	possibly damaging	0.67
R4606:Gys2	UTSW	6	142454484	missense	possibly damaging	0.92
R5338:Gys2	UTSW	6	142454513	missense	probably damaging	1.00
R5411:Gys2	UTSW	6	142448421	missense	probably damaging	0.99
R6072:Gys2	UTSW	6	142428537	missense	probably damaging	0.98
R6366:Gys2	UTSW	6	142463394	missense	probably benign	0.02
R6597:Gys2	UTSW	6	142456309	missense	probably benign	0.25
R6930:Gys2	UTSW	6	142459380	critical splice donor site	probably null
R7033:Gys2	UTSW	6	142472722	missense	probably benign	0.08
R7663:Gys2	UTSW	6	142459485	missense	probably damaging	1.00
R7757:Gys2	UTSW	6	142454451	missense	probably benign	0.10
R7848:Gys2	UTSW	6	142446015	nonsense	probably null
R7852:Gys2	UTSW	6	142430333	missense	probably damaging	1.00
R7931:Gys2	UTSW	6	142446015	nonsense	probably null
R7935:Gys2	UTSW	6	142430333	missense	probably damaging	1.00
R8008:Gys2	UTSW	6	142454517	missense	probably damaging	1.00
R8037:Gys2	UTSW	6	142448393	missense	probably benign	0.44
R8070:Gys2	UTSW	6	142448504	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GAGCAGAATTCAGGTCTCTCAAC -3'
(R):5'- TTCTGATGCAGGTGACAGACC -3'

Sequencing Primer
(F):5'- TGCACTCTGAGCAAAATTAAGC -3'
(R):5'- GGTGACAGACCACGCAGAC -3'

Posted On

2018-03-15