Incidental Mutation 'R7727:Sh3tc2'
ID595598
Institutional Source Beutler Lab
Gene Symbol Sh3tc2
Ensembl Gene ENSMUSG00000045629
Gene NameSH3 domain and tetratricopeptide repeats 2
SynonymsD430044G18Rik
Accession Numbers

Genbank: NM_172628

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7727 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location61953075-62015715 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 61989580 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 471 (I471F)
Ref Sequence ENSEMBL: ENSMUSP00000055094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051720]
Predicted Effect probably benign
Transcript: ENSMUST00000051720
AA Change: I471F

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000055094
Gene: ENSMUSG00000045629
AA Change: I471F

DomainStartEndE-ValueType
coiled coil region 75 101 N/A INTRINSIC
SH3 179 238 1.02e0 SMART
SH3 270 329 6.76e-5 SMART
low complexity region 414 425 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
low complexity region 486 503 N/A INTRINSIC
TPR 529 562 3.24e1 SMART
low complexity region 568 581 N/A INTRINSIC
TPR 837 870 2.66e0 SMART
Blast:TPR 877 910 2e-7 BLAST
low complexity region 1011 1025 N/A INTRINSIC
Blast:TPR 1045 1078 1e-12 BLAST
Blast:TPR 1127 1158 3e-7 BLAST
TPR 1167 1200 1.04e-2 SMART
Blast:TPR 1211 1235 5e-7 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two N-terminal Src homology 3 (SH3) domains and 10 tetratricopeptide repeat (TPR) motifs, and is a member of a small gene family. The gene product has been proposed to be an adapter or docking molecule. Mutations in this gene result in autosomal recessive Charcot-Marie-Tooth disease type 4C, a childhood-onset neurodegenerative disease characterized by demyelination of motor and sensory neurons. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypomyelination of peripheral axons with reduced conduction velocity and limb grasping. [provided by MGI curators]
Allele List at MGI

 All alleles(3) : Targeted, other(3)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik C A 6: 41,033,193 R69L probably benign Het
Adamts5 A T 16: 85,899,966 L101Q probably damaging Het
Arhgap18 A T 10: 26,870,011 I293F possibly damaging Het
Atp8b1 T A 18: 64,545,275 Q850L probably damaging Het
B4galnt3 A T 6: 120,225,187 F118Y probably benign Het
Bcl6 A G 16: 23,971,413 probably null Het
Cc2d2b T A 19: 40,756,530 L31Q probably benign Het
Cd5l G T 3: 87,367,855 E234* probably null Het
Cfap65 T C 1: 74,926,625 T409A probably benign Het
Chst5 A T 8: 111,890,925 I21N probably benign Het
Cldn20 T C 17: 3,532,755 Y68H probably benign Het
Col4a4 T C 1: 82,528,793 M269V unknown Het
Dgkh A G 14: 78,595,145 probably null Het
Dpp6 A G 5: 27,451,244 T166A probably benign Het
Drosha A G 15: 12,881,645 D754G probably damaging Het
Epb41l4a C A 18: 33,854,273 K350N probably damaging Het
Fsd1 T G 17: 55,988,150 D46E probably benign Het
Gabra1 T C 11: 42,133,591 D419G probably damaging Het
Golga4 T A 9: 118,548,702 D458E probably damaging Het
Grm6 C A 11: 50,851,542 A134E probably benign Het
Ikzf1 T A 11: 11,748,339 S63R probably damaging Het
Ilvbl G A 10: 78,576,666 V74I probably benign Het
Kcng2 C T 18: 80,296,090 V328M probably benign Het
Kpna7 T C 5: 145,005,045 E145G probably benign Het
Krt81 A G 15: 101,459,567 V428A probably damaging Het
Lalba T C 15: 98,482,668 M2V probably benign Het
Lrpprc T C 17: 84,776,947 S113G probably benign Het
Mboat1 A C 13: 30,226,306 M249L probably benign Het
Meltf T C 16: 31,883,794 V113A probably damaging Het
Muc16 T A 9: 18,660,242 H327L unknown Het
Myh1 A G 11: 67,215,922 I1277V probably benign Het
Naf1 GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC 8: 66,860,548 probably benign Het
Naga C A 15: 82,330,147 V388L probably benign Het
Nfkb1 A C 3: 135,585,401 M957R possibly damaging Het
Nol12 C A 15: 78,940,593 S157* probably null Het
Olfr1000 A G 2: 85,608,407 F168L possibly damaging Het
Olfr1038-ps A T 2: 86,122,496 D191V possibly damaging Het
Olfr272 A G 4: 52,911,368 V142A possibly damaging Het
Pcdhga5 T C 18: 37,695,045 V182A probably benign Het
Pik3r4 A G 9: 105,669,882 E953G probably damaging Het
Piwil2 C T 14: 70,394,057 R646Q probably damaging Het
Plxnc1 T C 10: 94,944,109 H157R probably damaging Het
Prrg4 A T 2: 104,839,378 F131L probably benign Het
Rab28 A G 5: 41,707,970 S4P probably damaging Het
Ranbp2 C A 10: 58,455,438 Q209K probably benign Het
Schip1 G A 3: 68,064,984 D15N probably benign Het
Serpina3f T G 12: 104,218,218 M207R probably benign Het
Sgsm1 A T 5: 113,274,327 M487K possibly damaging Het
Slamf1 G A 1: 171,774,899 V65I possibly damaging Het
Slit3 T C 11: 35,684,044 C1062R probably damaging Het
Snapc4 T G 2: 26,373,434 K344N probably damaging Het
Sorl1 A G 9: 41,984,526 Y1778H probably damaging Het
Spon2 G A 5: 33,215,675 R228C probably damaging Het
Sv2c A G 13: 95,976,695 I582T possibly damaging Het
Tamm41 C T 6: 115,016,178 V205M probably damaging Het
Tmem2 C T 19: 21,829,957 L917F probably benign Het
Trpm2 T C 10: 77,925,789 D1009G probably benign Het
Trpm6 T C 19: 18,854,249 S1493P probably damaging Het
Ttc34 G A 4: 154,839,274 V147I possibly damaging Het
Uba2 C T 7: 34,150,850 A393T probably damaging Het
Ubn2 T A 6: 38,463,938 N416K probably benign Het
Uevld T C 7: 46,943,805 N233S probably benign Het
Upp2 G A 2: 58,774,148 M142I possibly damaging Het
Vps52 T A 17: 33,962,134 V450D probably benign Het
Wdr31 A T 4: 62,460,636 F118Y probably damaging Het
Zcchc6 A G 13: 59,799,682 F942L probably benign Het
Zfp110 T A 7: 12,848,995 D523E possibly damaging Het
Zfp367 A T 13: 64,145,643 V143D probably damaging Het
Zfp950 T C 19: 61,119,941 I235V probably benign Het
Other mutations in Sh3tc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01146:Sh3tc2 APN 18 61989511 missense probably damaging 1.00
IGL01523:Sh3tc2 APN 18 61990883 missense probably benign 0.00
IGL02036:Sh3tc2 APN 18 62014907 missense probably benign 0.17
IGL02189:Sh3tc2 APN 18 61990622 missense probably benign 0.00
IGL02555:Sh3tc2 APN 18 61990237 missense probably damaging 0.99
IGL02827:Sh3tc2 APN 18 62013159 missense probably benign 0.34
IGL03033:Sh3tc2 APN 18 61974478 missense possibly damaging 0.90
IGL03040:Sh3tc2 APN 18 61989410 missense probably benign 0.00
IGL03062:Sh3tc2 APN 18 62011880 missense probably damaging 1.00
IGL03386:Sh3tc2 APN 18 61973311 missense probably benign 0.39
3-1:Sh3tc2 UTSW 18 61991138 missense probably damaging 1.00
R1085:Sh3tc2 UTSW 18 62014996 missense probably benign 0.01
R1166:Sh3tc2 UTSW 18 61991176 missense probably damaging 0.99
R1182:Sh3tc2 UTSW 18 61968100 missense probably benign 0.17
R1521:Sh3tc2 UTSW 18 62008488 missense probably damaging 0.96
R1636:Sh3tc2 UTSW 18 61989721 missense probably damaging 0.98
R1872:Sh3tc2 UTSW 18 62011883 missense probably damaging 1.00
R1884:Sh3tc2 UTSW 18 62008575 missense probably damaging 1.00
R1964:Sh3tc2 UTSW 18 61991155 nonsense probably null
R2034:Sh3tc2 UTSW 18 61987666 missense probably damaging 1.00
R2046:Sh3tc2 UTSW 18 61990843 missense probably benign
R2113:Sh3tc2 UTSW 18 62013105 missense probably damaging 1.00
R2363:Sh3tc2 UTSW 18 61990895 missense probably benign 0.07
R2940:Sh3tc2 UTSW 18 61989686 missense probably damaging 1.00
R2979:Sh3tc2 UTSW 18 61989485 missense probably damaging 1.00
R3717:Sh3tc2 UTSW 18 61990343 missense probably benign 0.04
R3718:Sh3tc2 UTSW 18 61990343 missense probably benign 0.04
R4334:Sh3tc2 UTSW 18 61990321 missense probably damaging 1.00
R4454:Sh3tc2 UTSW 18 62007773 missense probably damaging 1.00
R4503:Sh3tc2 UTSW 18 61974623 missense probably damaging 0.96
R4515:Sh3tc2 UTSW 18 61987693 splice site probably null
R4659:Sh3tc2 UTSW 18 61974509 missense probably benign 0.00
R4859:Sh3tc2 UTSW 18 62013093 missense probably benign 0.00
R4901:Sh3tc2 UTSW 18 61990435 missense probably benign 0.03
R5033:Sh3tc2 UTSW 18 62014891 splice site probably null
R5269:Sh3tc2 UTSW 18 61975613 missense probably benign 0.00
R5439:Sh3tc2 UTSW 18 61989633 nonsense probably null
R5467:Sh3tc2 UTSW 18 61990688 missense possibly damaging 0.81
R5468:Sh3tc2 UTSW 18 61973431 critical splice donor site probably null
R5527:Sh3tc2 UTSW 18 62011861 missense probably benign 0.00
R5829:Sh3tc2 UTSW 18 61990915 missense probably benign 0.19
R5880:Sh3tc2 UTSW 18 61973311 missense probably benign 0.39
R5948:Sh3tc2 UTSW 18 62013105 missense probably damaging 1.00
R5951:Sh3tc2 UTSW 18 61990007 missense probably damaging 1.00
R5973:Sh3tc2 UTSW 18 61977904 missense probably benign 0.06
R5995:Sh3tc2 UTSW 18 61990010 missense probably damaging 0.96
R6309:Sh3tc2 UTSW 18 61968010 missense probably damaging 0.98
R6339:Sh3tc2 UTSW 18 61975571 nonsense probably null
R6648:Sh3tc2 UTSW 18 62015040 missense probably benign 0.00
R6723:Sh3tc2 UTSW 18 61977954 missense probably damaging 1.00
R6752:Sh3tc2 UTSW 18 61961037 missense probably benign 0.00
R7211:Sh3tc2 UTSW 18 61989403 missense probably benign
R7367:Sh3tc2 UTSW 18 61989506 missense probably benign 0.00
R7664:Sh3tc2 UTSW 18 62014971 nonsense probably null
R7823:Sh3tc2 UTSW 18 61953117 start codon destroyed probably null 1.00
Z1176:Sh3tc2 UTSW 18 61989909 nonsense probably null
Z1177:Sh3tc2 UTSW 18 61989688 missense probably damaging 1.00
Z1177:Sh3tc2 UTSW 18 61991318 missense probably benign 0.09
Z1177:Sh3tc2 UTSW 18 62014991 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACCATAGGCTCTAGGCGTTC -3'
(R):5'- GCCTGAGAAAGTTTGGTCTTC -3'

Sequencing Primer
(F):5'- TCTAGGCGTTCCAGCGGTTC -3'
(R):5'- TGATGCTTAGTCGGCCCAG -3'
Posted On2019-11-12