Incidental Mutation 'R8219:Sh3tc2'
ID636584
Institutional Source Beutler Lab
Gene Symbol Sh3tc2
Ensembl Gene ENSMUSG00000045629
Gene NameSH3 domain and tetratricopeptide repeats 2
SynonymsD430044G18Rik
MMRRC Submission
Accession Numbers

Genbank: NM_172628

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8219 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location61953075-62015715 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62011861 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1129 (I1129V)
Ref Sequence ENSEMBL: ENSMUSP00000055094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051720]
Predicted Effect probably benign
Transcript: ENSMUST00000051720
AA Change: I1129V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000055094
Gene: ENSMUSG00000045629
AA Change: I1129V

DomainStartEndE-ValueType
coiled coil region 75 101 N/A INTRINSIC
SH3 179 238 1.02e0 SMART
SH3 270 329 6.76e-5 SMART
low complexity region 414 425 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
low complexity region 486 503 N/A INTRINSIC
TPR 529 562 3.24e1 SMART
low complexity region 568 581 N/A INTRINSIC
TPR 837 870 2.66e0 SMART
Blast:TPR 877 910 2e-7 BLAST
low complexity region 1011 1025 N/A INTRINSIC
Blast:TPR 1045 1078 1e-12 BLAST
Blast:TPR 1127 1158 3e-7 BLAST
TPR 1167 1200 1.04e-2 SMART
Blast:TPR 1211 1235 5e-7 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.7%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two N-terminal Src homology 3 (SH3) domains and 10 tetratricopeptide repeat (TPR) motifs, and is a member of a small gene family. The gene product has been proposed to be an adapter or docking molecule. Mutations in this gene result in autosomal recessive Charcot-Marie-Tooth disease type 4C, a childhood-onset neurodegenerative disease characterized by demyelination of motor and sensory neurons. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypomyelination of peripheral axons with reduced conduction velocity and limb grasping. [provided by MGI curators]
Allele List at MGI

 All alleles(3) : Targeted, other(3)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933414I15Rik A T 11: 50,942,536 S80T unknown Het
Acnat1 T A 4: 49,447,748 I278F probably benign Het
Adgrf5 A T 17: 43,449,859 Q815L probably benign Het
Aff1 T A 5: 103,846,333 Y1022N probably damaging Het
Ahi1 A G 10: 21,074,436 K1034E probably benign Het
Ano8 A T 8: 71,480,713 L645Q unknown Het
Atg9b A G 5: 24,386,332 L756P probably damaging Het
Atp2b2 A T 6: 113,793,850 I411N probably damaging Het
BC080695 T G 4: 143,571,960 Y158D probably benign Het
Bmp6 T A 13: 38,345,987 C19S unknown Het
Borcs5 A G 6: 134,644,350 H27R probably benign Het
C77080 T A 4: 129,248,153 D65V possibly damaging Het
Cachd1 C A 4: 100,990,962 D1091E probably benign Het
Ccdc186 T A 19: 56,793,345 M801L probably benign Het
Clcn3 A T 8: 60,922,966 M658K probably damaging Het
Col1a1 C T 11: 94,943,358 R500C probably damaging Het
Cul4a T A 8: 13,146,540 D731E possibly damaging Het
Dnajb8 C T 6: 88,222,958 R159C possibly damaging Het
E2f7 T A 10: 110,759,843 V133E probably damaging Het
Fam161b T C 12: 84,346,874 E575G probably benign Het
Fubp1 T A 3: 152,220,466 V275D probably damaging Het
Gabrg1 T A 5: 70,774,300 R367* probably null Het
Gm6902 G A 7: 23,273,718 A128V probably benign Het
Gnptab A G 10: 88,433,792 T786A probably benign Het
Golga2 A G 2: 32,306,480 N981D probably damaging Het
Gsap A T 5: 21,251,115 I437L probably benign Het
Gulp1 A G 1: 44,754,341 probably null Het
Kcnn1 T C 8: 70,852,855 Y237C probably damaging Het
Klhl28 A T 12: 64,951,657 N354K probably benign Het
Lama3 T C 18: 12,439,360 Y541H probably benign Het
Lamc1 A G 1: 153,247,327 Y706H probably damaging Het
Lima1 G T 15: 99,780,790 T590K probably damaging Het
Lrrc38 G A 4: 143,350,733 G189R probably damaging Het
Mrgprb8 G A 7: 48,388,901 V107M possibly damaging Het
Mrpl3 T A 9: 105,057,072 N139K possibly damaging Het
Nudt16 T A 9: 105,130,437 N161I probably damaging Het
Obscn G A 11: 59,122,748 S1091L probably benign Het
Olfr1458 A C 19: 13,102,920 L122R probably damaging Het
Olfr894 A C 9: 38,219,372 D183A probably damaging Het
Oog4 T C 4: 143,439,938 M99V probably benign Het
Osbpl6 A T 2: 76,555,903 D303V probably damaging Het
Pcdhb21 T C 18: 37,514,655 F279S probably damaging Het
Peg3 G A 7: 6,708,365 T1286I probably benign Het
Phax A G 18: 56,575,682 N106S probably damaging Het
Pkdrej A G 15: 85,821,292 Y148H probably damaging Het
Ptprn2 C A 12: 117,184,737 Q706K probably benign Het
Rdh11 T G 12: 79,189,106 K23Q probably benign Het
Rit2 T A 18: 30,975,494 E146V probably damaging Het
Rnf141 T C 7: 110,837,265 probably benign Het
Sars T A 3: 108,445,062 E24V probably benign Het
Slc10a5 G T 3: 10,335,324 P92Q probably benign Het
Slc24a5 A T 2: 125,085,655 probably null Het
Slc5a8 A G 10: 88,921,699 Y517C probably damaging Het
Slc6a5 A G 7: 49,912,163 M148V probably benign Het
Sorl1 T C 9: 42,041,561 probably null Het
Tgm4 A T 9: 123,045,052 Y119F probably benign Het
Tgm6 A G 2: 130,151,280 K562R probably benign Het
Tlr3 T C 8: 45,397,979 E627G possibly damaging Het
Tmprss11f A G 5: 86,530,019 L297P probably damaging Het
Tpbgl T C 7: 99,625,771 H293R probably benign Het
Trank1 A C 9: 111,364,909 K667T probably damaging Het
Trpm1 A T 7: 64,201,951 Q139L probably benign Het
Ttf2 T G 3: 100,962,563 K398T possibly damaging Het
Xpa A T 4: 46,183,150 M213K probably benign Het
Zmym2 T A 14: 56,925,859 S623T probably benign Het
Other mutations in Sh3tc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01146:Sh3tc2 APN 18 61989511 missense probably damaging 1.00
IGL01523:Sh3tc2 APN 18 61990883 missense probably benign 0.00
IGL02036:Sh3tc2 APN 18 62014907 missense probably benign 0.17
IGL02189:Sh3tc2 APN 18 61990622 missense probably benign 0.00
IGL02555:Sh3tc2 APN 18 61990237 missense probably damaging 0.99
IGL02827:Sh3tc2 APN 18 62013159 missense probably benign 0.34
IGL03033:Sh3tc2 APN 18 61974478 missense possibly damaging 0.90
IGL03040:Sh3tc2 APN 18 61989410 missense probably benign 0.00
IGL03062:Sh3tc2 APN 18 62011880 missense probably damaging 1.00
IGL03386:Sh3tc2 APN 18 61973311 missense probably benign 0.39
3-1:Sh3tc2 UTSW 18 61991138 missense probably damaging 1.00
R1085:Sh3tc2 UTSW 18 62014996 missense probably benign 0.01
R1166:Sh3tc2 UTSW 18 61991176 missense probably damaging 0.99
R1182:Sh3tc2 UTSW 18 61968100 missense probably benign 0.17
R1521:Sh3tc2 UTSW 18 62008488 missense probably damaging 0.96
R1636:Sh3tc2 UTSW 18 61989721 missense probably damaging 0.98
R1872:Sh3tc2 UTSW 18 62011883 missense probably damaging 1.00
R1884:Sh3tc2 UTSW 18 62008575 missense probably damaging 1.00
R1964:Sh3tc2 UTSW 18 61991155 nonsense probably null
R2034:Sh3tc2 UTSW 18 61987666 missense probably damaging 1.00
R2046:Sh3tc2 UTSW 18 61990843 missense probably benign
R2113:Sh3tc2 UTSW 18 62013105 missense probably damaging 1.00
R2363:Sh3tc2 UTSW 18 61990895 missense probably benign 0.07
R2940:Sh3tc2 UTSW 18 61989686 missense probably damaging 1.00
R2979:Sh3tc2 UTSW 18 61989485 missense probably damaging 1.00
R3717:Sh3tc2 UTSW 18 61990343 missense probably benign 0.04
R3718:Sh3tc2 UTSW 18 61990343 missense probably benign 0.04
R4334:Sh3tc2 UTSW 18 61990321 missense probably damaging 1.00
R4454:Sh3tc2 UTSW 18 62007773 missense probably damaging 1.00
R4503:Sh3tc2 UTSW 18 61974623 missense probably damaging 0.96
R4515:Sh3tc2 UTSW 18 61987693 splice site probably null
R4659:Sh3tc2 UTSW 18 61974509 missense probably benign 0.00
R4859:Sh3tc2 UTSW 18 62013093 missense probably benign 0.00
R4901:Sh3tc2 UTSW 18 61990435 missense probably benign 0.03
R5033:Sh3tc2 UTSW 18 62014891 splice site probably null
R5269:Sh3tc2 UTSW 18 61975613 missense probably benign 0.00
R5439:Sh3tc2 UTSW 18 61989633 nonsense probably null
R5467:Sh3tc2 UTSW 18 61990688 missense possibly damaging 0.81
R5468:Sh3tc2 UTSW 18 61973431 critical splice donor site probably null
R5527:Sh3tc2 UTSW 18 62011861 missense probably benign 0.00
R5829:Sh3tc2 UTSW 18 61990915 missense probably benign 0.19
R5880:Sh3tc2 UTSW 18 61973311 missense probably benign 0.39
R5948:Sh3tc2 UTSW 18 62013105 missense probably damaging 1.00
R5951:Sh3tc2 UTSW 18 61990007 missense probably damaging 1.00
R5973:Sh3tc2 UTSW 18 61977904 missense probably benign 0.06
R5995:Sh3tc2 UTSW 18 61990010 missense probably damaging 0.96
R6309:Sh3tc2 UTSW 18 61968010 missense probably damaging 0.98
R6339:Sh3tc2 UTSW 18 61975571 nonsense probably null
R6648:Sh3tc2 UTSW 18 62015040 missense probably benign 0.00
R6723:Sh3tc2 UTSW 18 61977954 missense probably damaging 1.00
R6752:Sh3tc2 UTSW 18 61961037 missense probably benign 0.00
R7211:Sh3tc2 UTSW 18 61989403 missense probably benign
R7367:Sh3tc2 UTSW 18 61989506 missense probably benign 0.00
R7664:Sh3tc2 UTSW 18 62014971 nonsense probably null
R7727:Sh3tc2 UTSW 18 61989580 missense probably benign 0.02
R7823:Sh3tc2 UTSW 18 61953117 start codon destroyed probably null 1.00
R8191:Sh3tc2 UTSW 18 61973358 missense probably damaging 1.00
R8204:Sh3tc2 UTSW 18 61953129 missense probably damaging 1.00
R8260:Sh3tc2 UTSW 18 62013066 missense probably damaging 1.00
R8413:Sh3tc2 UTSW 18 61990802 missense probably damaging 1.00
R8413:Sh3tc2 UTSW 18 62015071 missense probably benign 0.30
Z1176:Sh3tc2 UTSW 18 61989909 nonsense probably null
Z1177:Sh3tc2 UTSW 18 61989688 missense probably damaging 1.00
Z1177:Sh3tc2 UTSW 18 61991318 missense probably benign 0.09
Z1177:Sh3tc2 UTSW 18 62014991 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GAAGGTTCAATGACCTCCAGTTC -3'
(R):5'- ACTGCCTCAATAGCCATGTG -3'

Sequencing Primer
(F):5'- CTTAAGCTAGCTACATCTGGGCAG -3'
(R):5'- GCCATGTGTAAGAAGTGTCTACTCC -3'
Posted On2020-07-13