Incidental Mutation 'R6363:Zdhhc21'
ID512573
Institutional Source Beutler Lab
Gene Symbol Zdhhc21
Ensembl Gene ENSMUSG00000028403
Gene Namezinc finger, DHHC domain containing 21
Synonyms9130404H11Rik, D130004H04Rik, dep
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R6363 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location82798738-82859958 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 82847674 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 8 (V8D)
Ref Sequence ENSEMBL: ENSMUSP00000121954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030110] [ENSMUST00000107239] [ENSMUST00000139401] [ENSMUST00000156055] [ENSMUST00000173741]
Predicted Effect probably damaging
Transcript: ENSMUST00000030110
AA Change: V8D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030110
Gene: ENSMUSG00000028403
AA Change: V8D

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 43 58 N/A INTRINSIC
Pfam:zf-DHHC 61 217 5.6e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107239
AA Change: V8D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102859
Gene: ENSMUSG00000028403
AA Change: V8D

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 45 65 N/A INTRINSIC
Pfam:zf-DHHC 85 218 3.6e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000139401
AA Change: V8D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121954
Gene: ENSMUSG00000028403
AA Change: V8D

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 43 58 N/A INTRINSIC
Pfam:zf-DHHC 61 110 3e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144139
Predicted Effect probably damaging
Transcript: ENSMUST00000156055
AA Change: V8D

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000173741
AA Change: V8D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133630
Gene: ENSMUSG00000028403
AA Change: V8D

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 43 58 N/A INTRINSIC
Pfam:zf-DHHC 61 125 1.5e-16 PFAM
Meta Mutation Damage Score 0.7809 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency 98% (51/52)
MGI Phenotype PHENOTYPE: Homozygous mutants of this epidermal acting gene have thin, short hair, many misshapen and disoriented hair follicles, and clumps of pigment reflecting remains of degenerating follicles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl4 A G 4: 111,566,785 probably benign Het
Antxrl G T 14: 34,069,287 C379F probably damaging Het
Camsap3 T C 8: 3,601,971 C256R probably damaging Het
Ccdc33 T C 9: 58,114,335 E254G probably benign Het
Ccndbp1 C T 2: 121,012,973 P282L probably damaging Het
Col5a1 C T 2: 27,928,195 T144I unknown Het
Csmd2 A T 4: 128,400,379 H1167L probably benign Het
Ctsk A T 3: 95,501,551 T82S probably damaging Het
Cyp3a41b A T 5: 145,570,387 F248I probably damaging Het
Dchs1 A G 7: 105,758,472 I2051T probably benign Het
Dnah17 A G 11: 118,110,505 F871L probably benign Het
Eif2b4 A G 5: 31,191,239 V210A probably damaging Het
Eral1 A G 11: 78,074,317 I385T probably damaging Het
Ercc8 T C 13: 108,183,870 L330P probably damaging Het
Etfa A G 9: 55,500,133 V24A probably damaging Het
Fcrl1 A T 3: 87,385,168 I156F probably damaging Het
Gm7298 A G 6: 121,788,606 Y1465C probably damaging Het
Gpr17 A G 18: 31,947,572 L146P probably damaging Het
Gpr171 A G 3: 59,097,892 I154T possibly damaging Het
Hid1 T A 11: 115,352,596 Y542F probably damaging Het
Hspa8 T C 9: 40,803,065 V219A probably damaging Het
Klhl24 C T 16: 20,120,183 T496I possibly damaging Het
Krtcap2 T C 3: 89,249,106 S64P probably damaging Het
Msh3 C A 13: 92,212,524 D1066Y probably damaging Het
Naaladl2 C T 3: 24,335,317 G323R possibly damaging Het
Nbas A G 12: 13,482,576 T1762A probably benign Het
Nr4a1 C T 15: 101,274,115 R557C probably damaging Het
Ogfrl1 T A 1: 23,370,113 H344L probably benign Het
Olfr476 A G 7: 107,967,750 M118V possibly damaging Het
Olfr539 T A 7: 140,668,082 F265Y possibly damaging Het
Olfr76 T A 19: 12,120,166 H182L possibly damaging Het
Olfr827 A C 10: 130,211,037 V31G possibly damaging Het
Orm2 G A 4: 63,362,604 probably null Het
Patj T A 4: 98,431,860 S455T probably benign Het
Pdgfra G T 5: 75,170,836 V336L possibly damaging Het
Prkaa1 T C 15: 5,176,956 L431S probably damaging Het
Ptgfrn A G 3: 101,045,578 V780A possibly damaging Het
Rb1 A T 14: 73,287,641 V184E probably benign Het
Rev1 T A 1: 38,071,489 H560L probably damaging Het
Serpinb13 A T 1: 107,000,774 R375* probably null Het
Slc8a2 C A 7: 16,134,045 D67E probably benign Het
Sos2 A T 12: 69,632,111 N307K probably benign Het
Srgap2 G A 1: 131,298,468 R36W probably damaging Het
Tas2r119 G T 15: 32,177,888 W200L possibly damaging Het
Tep1 T G 14: 50,824,548 K2575T probably benign Het
Ttc36 T A 9: 44,799,639 R131S probably damaging Het
Ttyh3 A T 5: 140,635,224 L195Q probably damaging Het
Uba7 G A 9: 107,980,183 probably null Het
Utp20 A C 10: 88,757,080 V2249G probably damaging Het
Wwc2 A T 8: 47,887,162 probably null Het
Zfp719 A G 7: 43,589,866 T293A probably benign Het
Other mutations in Zdhhc21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02887:Zdhhc21 APN 4 82844190 missense probably benign 0.43
IGL03172:Zdhhc21 APN 4 82806327 utr 3 prime probably benign
R4393:Zdhhc21 UTSW 4 82847654 missense possibly damaging 0.90
R4701:Zdhhc21 UTSW 4 82820334 missense possibly damaging 0.92
R4910:Zdhhc21 UTSW 4 82820331 missense possibly damaging 0.68
R5288:Zdhhc21 UTSW 4 82847692 missense probably damaging 1.00
R5339:Zdhhc21 UTSW 4 82838313 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACGCTGTACTTCAAAACATTCAC -3'
(R):5'- CCTGTGATGTTAGCCTCCTG -3'

Sequencing Primer
(F):5'- TGCCAGGAATATGTCCTTC -3'
(R):5'- GCCTCCTGGTTAAAGTGCTAAGAC -3'
Posted On2018-04-27