Incidental Mutation 'R6363:Klhl24'
ID512608
Institutional Source Beutler Lab
Gene Symbol Klhl24
Ensembl Gene ENSMUSG00000062901
Gene Namekelch-like 24
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R6363 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location20097542-20129221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 20120183 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 496 (T496I)
Ref Sequence ENSEMBL: ENSMUSP00000023509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023509]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023509
AA Change: T496I

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000023509
Gene: ENSMUSG00000062901
AA Change: T496I

DomainStartEndE-ValueType
BTB 66 163 3.49e-29 SMART
BACK 168 270 1.53e-38 SMART
Kelch 314 363 8.21e-2 SMART
Kelch 364 407 6.04e-3 SMART
Kelch 408 454 5.71e-13 SMART
Kelch 455 502 1.51e-3 SMART
Kelch 503 544 9.19e-1 SMART
Kelch 545 592 2.43e-7 SMART
Meta Mutation Damage Score 0.1388 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a ubiquitin ligase substrate receptor and is regulated by autoubiquitination. Variations in the translation initiation codon of this gene have been found, which result in an N-terminally truncated but more stable protein due to loss of the autoubiquitination function. The more stable mutant protein causes an increased ubiquitin and degradation of keratin 14, which leads to skin fragility and the potentially life-threatening disease epidermolysis bullosa. The encoded protein is also involved in the regulation of kainate receptors. [provided by RefSeq, Mar 2017]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl4 A G 4: 111,566,785 probably benign Het
Antxrl G T 14: 34,069,287 C379F probably damaging Het
Camsap3 T C 8: 3,601,971 C256R probably damaging Het
Ccdc33 T C 9: 58,114,335 E254G probably benign Het
Ccndbp1 C T 2: 121,012,973 P282L probably damaging Het
Col5a1 C T 2: 27,928,195 T144I unknown Het
Csmd2 A T 4: 128,400,379 H1167L probably benign Het
Ctsk A T 3: 95,501,551 T82S probably damaging Het
Cyp3a41b A T 5: 145,570,387 F248I probably damaging Het
Dchs1 A G 7: 105,758,472 I2051T probably benign Het
Dnah17 A G 11: 118,110,505 F871L probably benign Het
Eif2b4 A G 5: 31,191,239 V210A probably damaging Het
Eral1 A G 11: 78,074,317 I385T probably damaging Het
Ercc8 T C 13: 108,183,870 L330P probably damaging Het
Etfa A G 9: 55,500,133 V24A probably damaging Het
Fcrl1 A T 3: 87,385,168 I156F probably damaging Het
Gm7298 A G 6: 121,788,606 Y1465C probably damaging Het
Gpr17 A G 18: 31,947,572 L146P probably damaging Het
Gpr171 A G 3: 59,097,892 I154T possibly damaging Het
Hid1 T A 11: 115,352,596 Y542F probably damaging Het
Hspa8 T C 9: 40,803,065 V219A probably damaging Het
Krtcap2 T C 3: 89,249,106 S64P probably damaging Het
Msh3 C A 13: 92,212,524 D1066Y probably damaging Het
Naaladl2 C T 3: 24,335,317 G323R possibly damaging Het
Nbas A G 12: 13,482,576 T1762A probably benign Het
Nr4a1 C T 15: 101,274,115 R557C probably damaging Het
Ogfrl1 T A 1: 23,370,113 H344L probably benign Het
Olfr476 A G 7: 107,967,750 M118V possibly damaging Het
Olfr539 T A 7: 140,668,082 F265Y possibly damaging Het
Olfr76 T A 19: 12,120,166 H182L possibly damaging Het
Olfr827 A C 10: 130,211,037 V31G possibly damaging Het
Orm2 G A 4: 63,362,604 probably null Het
Patj T A 4: 98,431,860 S455T probably benign Het
Pdgfra G T 5: 75,170,836 V336L possibly damaging Het
Prkaa1 T C 15: 5,176,956 L431S probably damaging Het
Ptgfrn A G 3: 101,045,578 V780A possibly damaging Het
Rb1 A T 14: 73,287,641 V184E probably benign Het
Rev1 T A 1: 38,071,489 H560L probably damaging Het
Serpinb13 A T 1: 107,000,774 R375* probably null Het
Slc8a2 C A 7: 16,134,045 D67E probably benign Het
Sos2 A T 12: 69,632,111 N307K probably benign Het
Srgap2 G A 1: 131,298,468 R36W probably damaging Het
Tas2r119 G T 15: 32,177,888 W200L possibly damaging Het
Tep1 T G 14: 50,824,548 K2575T probably benign Het
Ttc36 T A 9: 44,799,639 R131S probably damaging Het
Ttyh3 A T 5: 140,635,224 L195Q probably damaging Het
Uba7 G A 9: 107,980,183 probably null Het
Utp20 A C 10: 88,757,080 V2249G probably damaging Het
Wwc2 A T 8: 47,887,162 probably null Het
Zdhhc21 A T 4: 82,847,674 V8D probably damaging Het
Zfp719 A G 7: 43,589,866 T293A probably benign Het
Other mutations in Klhl24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Klhl24 APN 16 20122967 missense possibly damaging 0.78
IGL02419:Klhl24 APN 16 20107368 nonsense probably null
IGL02504:Klhl24 APN 16 20115943 nonsense probably null
IGL02799:Klhl24 UTSW 16 20114581 missense probably damaging 1.00
PIT4585001:Klhl24 UTSW 16 20106888 missense probably benign
R1512:Klhl24 UTSW 16 20122936 missense probably damaging 1.00
R1658:Klhl24 UTSW 16 20107092 nonsense probably null
R2076:Klhl24 UTSW 16 20117878 missense probably damaging 0.98
R2504:Klhl24 UTSW 16 20120167 missense probably benign 0.00
R4084:Klhl24 UTSW 16 20114562 missense probably damaging 0.98
R4299:Klhl24 UTSW 16 20107004 missense probably damaging 1.00
R4624:Klhl24 UTSW 16 20120123 missense probably damaging 1.00
R4780:Klhl24 UTSW 16 20106958 missense probably damaging 0.99
R5652:Klhl24 UTSW 16 20120247 nonsense probably null
R5827:Klhl24 UTSW 16 20120121 nonsense probably null
R6734:Klhl24 UTSW 16 20107529 missense probably damaging 1.00
R7069:Klhl24 UTSW 16 20107481 missense probably benign 0.06
R7361:Klhl24 UTSW 16 20118000 missense probably benign
R7482:Klhl24 UTSW 16 20114655 missense possibly damaging 0.48
R7894:Klhl24 UTSW 16 20123000 missense probably damaging 1.00
R8229:Klhl24 UTSW 16 20114571 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- CTTGACCAAGAAGCAAGAATTTTCC -3'
(R):5'- AATAATCAGGTCACTTGTTCCCTC -3'

Sequencing Primer
(F):5'- CCAAGAAGCAAGAATTTTCCTAATAC -3'
(R):5'- CTTGTATTTCTGTCTGGACTCTCTG -3'
Posted On2018-04-27