Incidental Mutation 'R6363:Tas2r119'
ID 512606
Institutional Source Beutler Lab
Gene Symbol Tas2r119
Ensembl Gene ENSMUSG00000045267
Gene Name taste receptor, type 2, member 119
Synonyms mGR19, T2R19, mt2r19, Tas2r19
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6363 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 32177289-32178294 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 32177888 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Leucine at position 200 (W200L)
Ref Sequence ENSEMBL: ENSMUSP00000050277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057633]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000057633
AA Change: W200L

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000050277
Gene: ENSMUSG00000045267
AA Change: W200L

DomainStartEndE-ValueType
Pfam:TAS2R 1 293 1.1e-90 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.4%
  • 20x: 91.9%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of candidate taste receptors that are members of the G protein-coupled receptor superfamily and that are specifically expressed by taste receptor cells of the tongue and palate epithelia. This intronless taste receptor gene encodes a 7-transmembrane receptor protein, functioning as a bitter taste receptor. This gene is mapped to chromosome 5p15, the location of a genetic locus (PROP) that controls the detection of the bitter compound 6-n-propyl-2-thiouracil. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agbl4 A G 4: 111,566,785 probably benign Het
Antxrl G T 14: 34,069,287 C379F probably damaging Het
Camsap3 T C 8: 3,601,971 C256R probably damaging Het
Ccdc33 T C 9: 58,114,335 E254G probably benign Het
Ccndbp1 C T 2: 121,012,973 P282L probably damaging Het
Col5a1 C T 2: 27,928,195 T144I unknown Het
Csmd2 A T 4: 128,400,379 H1167L probably benign Het
Ctsk A T 3: 95,501,551 T82S probably damaging Het
Cyp3a41b A T 5: 145,570,387 F248I probably damaging Het
Dchs1 A G 7: 105,758,472 I2051T probably benign Het
Dnah17 A G 11: 118,110,505 F871L probably benign Het
Eif2b4 A G 5: 31,191,239 V210A probably damaging Het
Eral1 A G 11: 78,074,317 I385T probably damaging Het
Ercc8 T C 13: 108,183,870 L330P probably damaging Het
Etfa A G 9: 55,500,133 V24A probably damaging Het
Fcrl1 A T 3: 87,385,168 I156F probably damaging Het
Gm7298 A G 6: 121,788,606 Y1465C probably damaging Het
Gpr17 A G 18: 31,947,572 L146P probably damaging Het
Gpr171 A G 3: 59,097,892 I154T possibly damaging Het
Hid1 T A 11: 115,352,596 Y542F probably damaging Het
Hspa8 T C 9: 40,803,065 V219A probably damaging Het
Klhl24 C T 16: 20,120,183 T496I possibly damaging Het
Krtcap2 T C 3: 89,249,106 S64P probably damaging Het
Msh3 C A 13: 92,212,524 D1066Y probably damaging Het
Naaladl2 C T 3: 24,335,317 G323R possibly damaging Het
Nbas A G 12: 13,482,576 T1762A probably benign Het
Nr4a1 C T 15: 101,274,115 R557C probably damaging Het
Ogfrl1 T A 1: 23,370,113 H344L probably benign Het
Olfr476 A G 7: 107,967,750 M118V possibly damaging Het
Olfr539 T A 7: 140,668,082 F265Y possibly damaging Het
Olfr76 T A 19: 12,120,166 H182L possibly damaging Het
Olfr827 A C 10: 130,211,037 V31G possibly damaging Het
Orm2 G A 4: 63,362,604 probably null Het
Patj T A 4: 98,431,860 S455T probably benign Het
Pdgfra G T 5: 75,170,836 V336L possibly damaging Het
Prkaa1 T C 15: 5,176,956 L431S probably damaging Het
Ptgfrn A G 3: 101,045,578 V780A possibly damaging Het
Rb1 A T 14: 73,287,641 V184E probably benign Het
Rev1 T A 1: 38,071,489 H560L probably damaging Het
Serpinb13 A T 1: 107,000,774 R375* probably null Het
Slc8a2 C A 7: 16,134,045 D67E probably benign Het
Sos2 A T 12: 69,632,111 N307K probably benign Het
Srgap2 G A 1: 131,298,468 R36W probably damaging Het
Tep1 T G 14: 50,824,548 K2575T probably benign Het
Ttc36 T A 9: 44,799,639 R131S probably damaging Het
Ttyh3 A T 5: 140,635,224 L195Q probably damaging Het
Uba7 G A 9: 107,980,183 probably null Het
Utp20 A C 10: 88,757,080 V2249G probably damaging Het
Wwc2 A T 8: 47,887,162 probably null Het
Zdhhc21 A T 4: 82,847,674 V8D probably damaging Het
Zfp719 A G 7: 43,589,866 T293A probably benign Het
Other mutations in Tas2r119
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Tas2r119 APN 15 32177453 missense probably damaging 0.97
IGL01522:Tas2r119 APN 15 32178193 missense probably benign 0.15
IGL01548:Tas2r119 APN 15 32177977 missense probably damaging 1.00
IGL01826:Tas2r119 APN 15 32177402 missense probably damaging 1.00
IGL02432:Tas2r119 APN 15 32177707 missense probably benign 0.06
IGL02585:Tas2r119 APN 15 32177533 missense probably benign 0.04
R2248:Tas2r119 UTSW 15 32178151 missense possibly damaging 0.51
R2432:Tas2r119 UTSW 15 32178019 missense possibly damaging 0.80
R5098:Tas2r119 UTSW 15 32178082 missense probably benign 0.03
R5624:Tas2r119 UTSW 15 32177968 missense probably damaging 1.00
R5819:Tas2r119 UTSW 15 32177306 missense probably damaging 1.00
R5901:Tas2r119 UTSW 15 32177786 missense possibly damaging 0.84
R6495:Tas2r119 UTSW 15 32177530 missense probably benign
R6521:Tas2r119 UTSW 15 32178173 missense probably damaging 1.00
R7574:Tas2r119 UTSW 15 32178133 missense probably damaging 1.00
R9004:Tas2r119 UTSW 15 32177963 missense probably damaging 1.00
R9015:Tas2r119 UTSW 15 32178080 missense probably damaging 1.00
R9193:Tas2r119 UTSW 15 32177786 missense probably benign 0.02
X0063:Tas2r119 UTSW 15 32178155 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TATCCAGGTTGGTGCCATG -3'
(R):5'- AAAGGTTCTGCTTCCAAAGTGG -3'

Sequencing Primer
(F):5'- CATGGCTGATCCTGGCATCTG -3'
(R):5'- TCCAAAGTGGAGGCCTTGG -3'
Posted On 2018-04-27