Incidental Mutation 'R6332:Pdpk1'
ID513206
Institutional Source Beutler Lab
Gene Symbol Pdpk1
Ensembl Gene ENSMUSG00000024122
Gene Name3-phosphoinositide dependent protein kinase 1
SynonymsPkb kinase, Pdk1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6332 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location24073680-24150924 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24106922 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 100 (V100D)
Ref Sequence ENSEMBL: ENSMUSP00000121771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052462] [ENSMUST00000102927] [ENSMUST00000115407] [ENSMUST00000115409] [ENSMUST00000115411] [ENSMUST00000128997] [ENSMUST00000144533] [ENSMUST00000154982]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052462
AA Change: V100D

PolyPhen 2 Score 0.500 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000061942
Gene: ENSMUSG00000024122
AA Change: V100D

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
S_TKc 58 318 4.07e-97 SMART
low complexity region 364 380 N/A INTRINSIC
Pfam:PH_3 422 524 1.6e-47 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102927
AA Change: V127D

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099991
Gene: ENSMUSG00000024122
AA Change: V127D

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 35 44 N/A INTRINSIC
low complexity region 65 77 N/A INTRINSIC
S_TKc 85 345 4.07e-97 SMART
low complexity region 391 407 N/A INTRINSIC
Pfam:PH_3 449 551 1.3e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115407
AA Change: V127D

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111066
Gene: ENSMUSG00000024122
AA Change: V127D

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 35 44 N/A INTRINSIC
low complexity region 65 77 N/A INTRINSIC
S_TKc 85 345 4.07e-97 SMART
low complexity region 391 407 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115409
SMART Domains Protein: ENSMUSP00000111068
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 35 44 N/A INTRINSIC
low complexity region 65 77 N/A INTRINSIC
Pfam:Pkinase 110 217 3.6e-18 PFAM
low complexity region 264 280 N/A INTRINSIC
Pfam:PH_3 322 424 2.3e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000115411
AA Change: V127D

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000111070
Gene: ENSMUSG00000024122
AA Change: V127D

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 35 44 N/A INTRINSIC
low complexity region 65 77 N/A INTRINSIC
S_TKc 85 345 4.07e-97 SMART
low complexity region 391 407 N/A INTRINSIC
Pfam:PH_3 449 522 4.9e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128997
SMART Domains Protein: ENSMUSP00000120548
Gene: ENSMUSG00000024122

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140906
Predicted Effect probably damaging
Transcript: ENSMUST00000144533
AA Change: V100D

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121771
Gene: ENSMUSG00000024122
AA Change: V100D

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
Pfam:Pkinase 58 128 2.8e-12 PFAM
Pfam:Pkinase_Tyr 58 128 9.2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150578
Predicted Effect possibly damaging
Transcript: ENSMUST00000154982
AA Change: V100D

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000115618
Gene: ENSMUSG00000024122
AA Change: V100D

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
Pfam:Pkinase 58 111 6e-7 PFAM
Meta Mutation Damage Score 0.7800 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 99% (67/68)
MGI Phenotype PHENOTYPE: Homozygous mutant mice exhibit embryogenesis defects, impaired forebrain development, and die by mid gestation. Cardiac muscle-specific conditional mutants exhibit thin ventricular walls and die of heart failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933421I07Rik C A 7: 42,446,243 G194C possibly damaging Het
Adamtsl1 A G 4: 86,217,011 K258E probably damaging Het
Afdn A T 17: 13,810,445 D206V possibly damaging Het
Agt G T 8: 124,557,833 Q389K possibly damaging Het
Ankrd44 A T 1: 54,762,273 D298E probably damaging Het
Anks1 A G 17: 28,052,735 S897G probably benign Het
Apol9b A G 15: 77,735,546 probably null Het
Baz1a T C 12: 54,918,554 E705G probably benign Het
BC048679 C T 7: 81,495,218 V126M probably benign Het
Cep295 A G 9: 15,334,914 F749L possibly damaging Het
Cntrl T A 2: 35,128,024 I482K possibly damaging Het
Col6a3 A G 1: 90,822,233 F293S probably damaging Het
Dnah12 T G 14: 26,717,974 M527R probably damaging Het
Dnhd1 G A 7: 105,694,066 R1539H probably benign Het
Ece1 A G 4: 137,958,008 Y603C probably damaging Het
Eea1 G A 10: 96,041,473 A1350T possibly damaging Het
Exoc3l4 A T 12: 111,427,968 K507N possibly damaging Het
Fam126b T A 1: 58,529,875 Y515F probably damaging Het
Fam35a A G 14: 34,268,172 V259A probably benign Het
Flt3l A T 7: 45,133,667 probably null Het
Fn1 T C 1: 71,628,071 Q834R probably benign Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Ifih1 T C 2: 62,639,483 N157D possibly damaging Het
Itga2 A C 13: 114,843,473 M1064R probably benign Het
Itgae A G 11: 73,111,402 probably null Het
Krtap10-4 T C 10: 77,827,049 probably benign Het
Lamp3 A G 16: 19,699,681 C269R probably damaging Het
Lrp5 T C 19: 3,659,355 D125G probably damaging Het
Matn2 A C 15: 34,423,755 E586D probably benign Het
Mef2b T A 8: 70,164,139 probably null Het
Mrps22 A G 9: 98,601,471 probably null Het
Mtmr2 T C 9: 13,800,029 F445L probably damaging Het
Nxph4 A G 10: 127,526,368 V218A probably damaging Het
Olfr1308 C T 2: 111,960,746 G109D probably damaging Het
Olfr382 A G 11: 73,517,175 V8A probably benign Het
Olfr639 A G 7: 104,011,773 S310P probably benign Het
Phldb2 A C 16: 45,774,246 S899A probably benign Het
Pnpla3 G A 15: 84,172,782 probably null Het
Rasal2 A G 1: 157,299,187 Y94H probably damaging Het
Rlf A T 4: 121,148,822 I987N possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rprd2 A G 3: 95,780,441 Y300H probably damaging Het
Setbp1 G A 18: 78,783,369 S1343L probably benign Het
Sfswap A G 5: 129,571,041 K938E possibly damaging Het
Slc3a1 A C 17: 85,028,432 M1L probably damaging Het
Slco5a1 C T 1: 12,921,185 V427I probably benign Het
Ssbp2 A T 13: 91,690,908 M300L probably benign Het
Ssc5d A G 7: 4,937,522 D878G probably damaging Het
Stk19 A G 17: 34,824,598 L212P probably damaging Het
Stk39 T C 2: 68,410,043 M115V possibly damaging Het
Syt17 A C 7: 118,434,243 S181A probably benign Het
Taar7b A T 10: 23,999,951 N5Y probably benign Het
Tmc4 A G 7: 3,677,422 probably null Het
Tmem248 T A 5: 130,229,469 M1K probably null Het
Tmem82 T A 4: 141,616,410 Q183L probably damaging Het
Tpd52l1 T C 10: 31,338,207 E142G probably damaging Het
Ttll2 A T 17: 7,351,768 H253Q probably damaging Het
Ttn T C 2: 76,857,464 probably benign Het
Ubd A G 17: 37,195,501 K93E probably benign Het
Ugt2b35 T A 5: 87,001,556 F222Y probably damaging Het
Vmn2r10 G T 5: 109,003,462 N95K probably damaging Het
Vwa8 T C 14: 79,197,464 V1775A probably benign Het
Zdbf2 A G 1: 63,307,822 K1787E possibly damaging Het
Zfp26 A T 9: 20,437,286 F661I probably damaging Het
Zfp735 A T 11: 73,711,678 K483* probably null Het
Zfp946 A G 17: 22,454,538 E91G probably damaging Het
Zic5 C A 14: 122,459,749 D485Y unknown Het
Zmynd8 A T 2: 165,838,852 D236E probably damaging Het
Other mutations in Pdpk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:Pdpk1 APN 17 24106861 missense possibly damaging 0.87
IGL01467:Pdpk1 APN 17 24088170 missense probably damaging 0.98
IGL02251:Pdpk1 APN 17 24079638 missense probably damaging 1.00
IGL03411:Pdpk1 APN 17 24101644 missense probably damaging 1.00
R0152:Pdpk1 UTSW 17 24106946 missense possibly damaging 0.93
R0610:Pdpk1 UTSW 17 24098171 critical splice acceptor site probably null
R1208:Pdpk1 UTSW 17 24093609 critical splice acceptor site probably null
R1208:Pdpk1 UTSW 17 24093609 critical splice acceptor site probably null
R1817:Pdpk1 UTSW 17 24110904 missense probably damaging 1.00
R1819:Pdpk1 UTSW 17 24110904 missense probably damaging 1.00
R1822:Pdpk1 UTSW 17 24098176 splice site probably benign
R1823:Pdpk1 UTSW 17 24098176 splice site probably benign
R3783:Pdpk1 UTSW 17 24110850 missense possibly damaging 0.95
R4653:Pdpk1 UTSW 17 24106897 missense probably benign 0.25
R5000:Pdpk1 UTSW 17 24111045 missense possibly damaging 0.66
R5385:Pdpk1 UTSW 17 24098140 nonsense probably null
R5425:Pdpk1 UTSW 17 24098121 missense probably damaging 1.00
R5429:Pdpk1 UTSW 17 24091560 missense probably benign 0.01
R5642:Pdpk1 UTSW 17 24106855 nonsense probably null
R5936:Pdpk1 UTSW 17 24093229 missense probably damaging 1.00
R6049:Pdpk1 UTSW 17 24098135 nonsense probably null
R6693:Pdpk1 UTSW 17 24111126 splice site probably null
R7423:Pdpk1 UTSW 17 24110900 missense probably benign 0.08
R7432:Pdpk1 UTSW 17 24101669 missense probably benign 0.43
RF016:Pdpk1 UTSW 17 24093281 missense probably benign 0.01
Z1177:Pdpk1 UTSW 17 24088013 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTCCAAGGAGATCAGTACACAG -3'
(R):5'- AAACCTTCTAACCGTGGGTGG -3'

Sequencing Primer
(F):5'- GTGCCCTTTCATTTCAAGGAACAAAC -3'
(R):5'- GGTGGGTGGTTTTGGGAC -3'
Posted On2018-04-27