Incidental Mutation 'R6343:Nup98'
ID514005
Institutional Source Beutler Lab
Gene Symbol Nup98
Ensembl Gene ENSMUSG00000063550
Gene Namenucleoporin 98
SynonymsNup96
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6343 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location102119398-102210176 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102194750 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 89 (N89S)
Ref Sequence ENSEMBL: ENSMUSP00000068530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070165] [ENSMUST00000210682] [ENSMUST00000211005] [ENSMUST00000211022] [ENSMUST00000211235]
Predicted Effect possibly damaging
Transcript: ENSMUST00000070165
AA Change: N89S

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000068530
Gene: ENSMUSG00000063550
AA Change: N89S

DomainStartEndE-ValueType
Pfam:Nucleoporin_FG 3 88 4.6e-4 PFAM
Pfam:Nucleoporin_FG 69 170 3.4e-6 PFAM
Pfam:Nucleoporin_FG 210 307 6.1e-5 PFAM
Pfam:Nucleoporin_FG 246 332 2.2e-7 PFAM
Pfam:Nucleoporin_FG 266 359 1.2e-7 PFAM
Pfam:Nucleoporin_FG 309 425 1.8e-2 PFAM
Pfam:Nucleoporin_FG 398 497 2.2e-2 PFAM
low complexity region 594 610 N/A INTRINSIC
low complexity region 673 684 N/A INTRINSIC
Pfam:Nucleoporin2 740 880 5.4e-45 PFAM
PDB:1KO6|D 881 925 1e-16 PDB
low complexity region 926 935 N/A INTRINSIC
low complexity region 1033 1042 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209242
Predicted Effect possibly damaging
Transcript: ENSMUST00000210682
AA Change: N89S

PolyPhen 2 Score 0.555 (Sensitivity: 0.88; Specificity: 0.91)
Predicted Effect probably benign
Transcript: ENSMUST00000211005
AA Change: N89S

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000211022
AA Change: N89S

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000211235
AA Change: N89S

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211375
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nuclear pore complexes (NPCs) regulate the transport of macromolecules between the nucleus and cytoplasm, and are composed of many polypeptide subunits, many of which belong to the nucleoporin family. This gene belongs to the nucleoporin gene family and encodes a 186 kDa precursor protein that undergoes autoproteolytic cleavage to generate a 98 kDa nucleoporin and 96 kDa nucleoporin. The 98 kDa nucleoporin contains a Gly-Leu-Phe-Gly (GLGF) repeat domain and participates in many cellular processes, including nuclear import, nuclear export, mitotic progression, and regulation of gene expression. The 96 kDa nucleoporin is a scaffold component of the NPC. Proteolytic cleavage is important for targeting of the proteins to the NPC. Translocations between this gene and many other partner genes have been observed in different leukemias. Rearrangements typically result in chimeras with the N-terminal GLGF domain of this gene to the C-terminus of the partner gene. Alternative splicing results in multiple transcript variants encoding different isoforms, at least two of which are proteolytically processed. Some variants lack the region that encodes the 96 kDa nucleoporin. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygotes for a null allele die in utero with a severe growth delay and improper gastrulation and nuclear pore complex assembly/function. Heterozygotes for another null allele show impaired IFN-mediated responses, reduced T and B cell subsets in lymphoid organs and altered T and B cell functions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,314,552 L301Q probably damaging Het
Adgrl4 T C 3: 151,517,806 L632P probably damaging Het
Cacna2d1 T A 5: 16,322,564 I539N probably benign Het
Camta1 T A 4: 151,079,849 H314L probably damaging Het
Car2 T C 3: 14,887,965 S56P probably damaging Het
Chrm5 G A 2: 112,479,448 A441V probably damaging Het
Ckap5 T A 2: 91,596,474 N1380K possibly damaging Het
Cspg4 T C 9: 56,892,692 V1580A probably benign Het
Dcc A G 18: 71,336,035 L1099P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Epha5 A T 5: 84,106,747 H644Q probably damaging Het
Eya3 T C 4: 132,672,910 I80T probably damaging Het
Fdft1 A T 14: 63,151,272 Y304N probably damaging Het
Fiz1 C T 7: 5,008,401 A373T possibly damaging Het
Gpatch2l T A 12: 86,260,605 Y252* probably null Het
Hivep1 G T 13: 42,159,671 G1796* probably null Het
Irf8 T C 8: 120,753,707 V228A probably damaging Het
Islr A C 9: 58,157,096 V376G probably damaging Het
Kdm5a T C 6: 120,382,933 V230A probably benign Het
Lpgat1 A G 1: 191,776,572 probably null Het
Lrp8 T C 4: 107,869,156 probably null Het
Lyzl4 A C 9: 121,578,084 S127A possibly damaging Het
Map4k1 T C 7: 29,000,290 V606A possibly damaging Het
Mau2 T A 8: 70,031,523 K138N probably damaging Het
Meikin T C 11: 54,370,766 L33P probably damaging Het
Mrpl28 T C 17: 26,126,278 V224A probably benign Het
Ncdn T C 4: 126,747,171 D512G possibly damaging Het
Nlrp2 T A 7: 5,300,926 Q200L possibly damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr1448 G T 19: 12,919,582 H242Q probably damaging Het
Olfr304 T A 7: 86,385,851 R270* probably null Het
Olfr551 A G 7: 102,588,546 C66R probably damaging Het
Olfr770 A T 10: 129,133,666 L34* probably null Het
Padi3 C T 4: 140,803,508 V68I possibly damaging Het
Pign A T 1: 105,585,095 M621K probably benign Het
Pigv C T 4: 133,665,236 V208M probably damaging Het
Ripk4 A G 16: 97,763,526 probably null Het
Rsf1 A G 7: 97,660,917 K285E probably benign Het
Serpina3k G C 12: 104,345,303 G380A probably benign Het
Sorbs1 A G 19: 40,376,982 probably null Het
Srrd G C 5: 112,340,000 A104G probably benign Het
Tbp T A 17: 15,501,089 probably null Het
Tecrl G A 5: 83,294,600 H209Y probably damaging Het
Tmprss11c A G 5: 86,256,345 L157P probably damaging Het
Tmprss13 A T 9: 45,343,200 T422S possibly damaging Het
Ttll5 A G 12: 85,956,699 H1103R probably benign Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Vldlr A G 19: 27,245,649 Y699C probably damaging Het
Vmn1r22 T G 6: 57,900,578 N138T possibly damaging Het
Other mutations in Nup98
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Nup98 APN 7 102194987 missense probably damaging 1.00
IGL00789:Nup98 APN 7 102153971 missense probably benign
IGL00798:Nup98 APN 7 102147204 missense probably damaging 1.00
IGL01562:Nup98 APN 7 102185918 missense probably damaging 0.99
IGL01942:Nup98 APN 7 102194711 missense probably damaging 1.00
IGL02109:Nup98 APN 7 102183486 missense probably benign 0.37
IGL02490:Nup98 APN 7 102152366 missense probably damaging 1.00
IGL03184:Nup98 APN 7 102183545 missense probably damaging 0.99
PIT4519001:Nup98 UTSW 7 102134964 missense probably benign 0.00
R0040:Nup98 UTSW 7 102192034 missense probably damaging 1.00
R0133:Nup98 UTSW 7 102139652 critical splice acceptor site probably null
R0309:Nup98 UTSW 7 102152428 missense probably null
R0471:Nup98 UTSW 7 102138797 missense probably benign 0.13
R0538:Nup98 UTSW 7 102186685 missense probably damaging 1.00
R0650:Nup98 UTSW 7 102152453 missense probably damaging 1.00
R0730:Nup98 UTSW 7 102160716 missense probably damaging 1.00
R0881:Nup98 UTSW 7 102160716 missense probably damaging 1.00
R0900:Nup98 UTSW 7 102160716 missense probably damaging 1.00
R1120:Nup98 UTSW 7 102160716 missense probably damaging 1.00
R1159:Nup98 UTSW 7 102160716 missense probably damaging 1.00
R1469:Nup98 UTSW 7 102138801 missense probably benign 0.00
R1469:Nup98 UTSW 7 102138801 missense probably benign 0.00
R1470:Nup98 UTSW 7 102147306 missense probably damaging 0.98
R1470:Nup98 UTSW 7 102147306 missense probably damaging 0.98
R1545:Nup98 UTSW 7 102134880 missense possibly damaging 0.77
R1775:Nup98 UTSW 7 102134937 missense probably benign 0.03
R1889:Nup98 UTSW 7 102160716 missense probably damaging 1.00
R2080:Nup98 UTSW 7 102180424 missense probably damaging 0.96
R3423:Nup98 UTSW 7 102184877 missense probably benign 0.03
R4361:Nup98 UTSW 7 102145714 missense probably damaging 1.00
R4678:Nup98 UTSW 7 102184831 missense probably damaging 1.00
R4864:Nup98 UTSW 7 102153196 missense possibly damaging 0.94
R4910:Nup98 UTSW 7 102195800 missense unknown
R4924:Nup98 UTSW 7 102134978 missense probably damaging 1.00
R5068:Nup98 UTSW 7 102145655 missense probably benign 0.00
R5069:Nup98 UTSW 7 102145655 missense probably benign 0.00
R5233:Nup98 UTSW 7 102195822 missense unknown
R5779:Nup98 UTSW 7 102152361 missense probably benign
R5922:Nup98 UTSW 7 102154017 missense probably damaging 1.00
R6010:Nup98 UTSW 7 102180429 missense probably damaging 1.00
R6039:Nup98 UTSW 7 102134795 missense probably benign
R6039:Nup98 UTSW 7 102134795 missense probably benign
R6364:Nup98 UTSW 7 102176315 missense probably damaging 1.00
R6462:Nup98 UTSW 7 102195016 missense probably benign 0.03
R6577:Nup98 UTSW 7 102128846 intron probably null
R6900:Nup98 UTSW 7 102185962 missense probably damaging 1.00
R7205:Nup98 UTSW 7 102195041 missense unknown
R7218:Nup98 UTSW 7 102191900 splice site probably null
R7235:Nup98 UTSW 7 102125284 missense probably damaging 1.00
R7307:Nup98 UTSW 7 102134795 missense probably benign
R7402:Nup98 UTSW 7 102134937 missense probably benign 0.00
R7584:Nup98 UTSW 7 102176389 missense probably benign 0.02
R7646:Nup98 UTSW 7 102154035 missense probably benign 0.01
R7648:Nup98 UTSW 7 102124197 missense possibly damaging 0.94
T0970:Nup98 UTSW 7 102186752 unclassified probably benign
X0054:Nup98 UTSW 7 102147208 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTTGGTGGGAAAGGAGAT -3'
(R):5'- AACCAGGTAAGGGATTTTGTTTGGAA -3'

Sequencing Primer
(F):5'- CTTGGTGGGAAAGGAGATAAGTAAAC -3'
(R):5'- AGGGATTTTGTTTGGAATATATCTGG -3'
Posted On2018-04-27