Incidental Mutation 'R6343:Tbp'
ID535629
Institutional Source Beutler Lab
Gene Symbol Tbp
Ensembl Gene ENSMUSG00000014767
Gene NameTATA box binding protein
SynonymsGtf2d
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6343 (G1)
Quality Score222.009
Status Validated
Chromosome17
Chromosomal Location15499888-15528379 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 15501089 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000143924] [ENSMUST00000159197]
Predicted Effect probably null
Transcript: ENSMUST00000143924
SMART Domains Protein: ENSMUSP00000122696
Gene: ENSMUSG00000014767

DomainStartEndE-ValueType
low complexity region 55 97 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
low complexity region 117 133 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159197
SMART Domains Protein: ENSMUSP00000125691
Gene: ENSMUSG00000014767

DomainStartEndE-ValueType
low complexity region 55 97 N/A INTRINSIC
low complexity region 103 115 N/A INTRINSIC
low complexity region 117 128 N/A INTRINSIC
Meta Mutation Damage Score 0.6372 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency 100% (51/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Initiation of transcription by RNA polymerase II requires the activities of more than 70 polypeptides. The protein that coordinates these activities is transcription factor IID (TFIID), which binds to the core promoter to position the polymerase properly, serves as the scaffold for assembly of the remainder of the transcription complex, and acts as a channel for regulatory signals. TFIID is composed of the TATA-binding protein (TBP) and a group of evolutionarily conserved proteins known as TBP-associated factors or TAFs. TAFs may participate in basal transcription, serve as coactivators, function in promoter recognition or modify general transcription factors (GTFs) to facilitate complex assembly and transcription initiation. This gene encodes TBP, the TATA-binding protein. A distinctive feature of TBP is a long string of glutamines in the N-terminus. This region of the protein modulates the DNA binding activity of the C terminus, and modulation of DNA binding affects the rate of transcription complex formation and initiation of transcription. The number of CAG repeats encoding the polyglutamine tract is usually 25-42, and expansion of the number of repeats to 45-66 increases the length of the polyglutamine string and is associated with spinocerebellar ataxia 17, a neurodegenerative disorder classified as a polyglutamine disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for one null allele exhibit embryonic lethality caused by hemorrhaging and clotting in the placenta and surviving embryos die prior to weaning. Mice homozygous for another null allele undergo growth arrest after hatching and apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 A T 11: 110,314,552 L301Q probably damaging Het
Adgrl4 T C 3: 151,517,806 L632P probably damaging Het
Cacna2d1 T A 5: 16,322,564 I539N probably benign Het
Camta1 T A 4: 151,079,849 H314L probably damaging Het
Car2 T C 3: 14,887,965 S56P probably damaging Het
Chrm5 G A 2: 112,479,448 A441V probably damaging Het
Ckap5 T A 2: 91,596,474 N1380K possibly damaging Het
Cspg4 T C 9: 56,892,692 V1580A probably benign Het
Dcc A G 18: 71,336,035 L1099P probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Epha5 A T 5: 84,106,747 H644Q probably damaging Het
Eya3 T C 4: 132,672,910 I80T probably damaging Het
Fdft1 A T 14: 63,151,272 Y304N probably damaging Het
Fiz1 C T 7: 5,008,401 A373T possibly damaging Het
Gpatch2l T A 12: 86,260,605 Y252* probably null Het
Hivep1 G T 13: 42,159,671 G1796* probably null Het
Irf8 T C 8: 120,753,707 V228A probably damaging Het
Islr A C 9: 58,157,096 V376G probably damaging Het
Kdm5a T C 6: 120,382,933 V230A probably benign Het
Lpgat1 A G 1: 191,776,572 probably null Het
Lrp8 T C 4: 107,869,156 probably null Het
Lyzl4 A C 9: 121,578,084 S127A possibly damaging Het
Map4k1 T C 7: 29,000,290 V606A possibly damaging Het
Mau2 T A 8: 70,031,523 K138N probably damaging Het
Meikin T C 11: 54,370,766 L33P probably damaging Het
Mrpl28 T C 17: 26,126,278 V224A probably benign Het
Ncdn T C 4: 126,747,171 D512G possibly damaging Het
Nlrp2 T A 7: 5,300,926 Q200L possibly damaging Het
Nup98 T C 7: 102,194,750 N89S possibly damaging Het
Ogfrl1 T G 1: 23,369,863 K427N probably benign Het
Olfr1448 G T 19: 12,919,582 H242Q probably damaging Het
Olfr304 T A 7: 86,385,851 R270* probably null Het
Olfr551 A G 7: 102,588,546 C66R probably damaging Het
Olfr770 A T 10: 129,133,666 L34* probably null Het
Padi3 C T 4: 140,803,508 V68I possibly damaging Het
Pign A T 1: 105,585,095 M621K probably benign Het
Pigv C T 4: 133,665,236 V208M probably damaging Het
Ripk4 A G 16: 97,763,526 probably null Het
Rsf1 A G 7: 97,660,917 K285E probably benign Het
Serpina3k G C 12: 104,345,303 G380A probably benign Het
Sorbs1 A G 19: 40,376,982 probably null Het
Srrd G C 5: 112,340,000 A104G probably benign Het
Tecrl G A 5: 83,294,600 H209Y probably damaging Het
Tmprss11c A G 5: 86,256,345 L157P probably damaging Het
Tmprss13 A T 9: 45,343,200 T422S possibly damaging Het
Ttll5 A G 12: 85,956,699 H1103R probably benign Het
Urb2 G T 8: 124,031,125 E1190D probably damaging Het
Vldlr A G 19: 27,245,649 Y699C probably damaging Het
Vmn1r22 T G 6: 57,900,578 N138T possibly damaging Het
Other mutations in Tbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02260:Tbp APN 17 15504616 missense probably damaging 1.00
R2424:Tbp UTSW 17 15513533 missense possibly damaging 0.94
R5288:Tbp UTSW 17 15507347 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ATCTGCTCTTTGACACAGGAG -3'
(R):5'- GTGCTCATGAATGGATGCTATG -3'

Sequencing Primer
(F):5'- GCTCTTTGACACAGGAGATACTC -3'
(R):5'- AGCTGTTCTGCGATTAAGAGCAC -3'
Posted On2018-09-13