Incidental Mutation 'R6415:Ercc1'
ID517861
Institutional Source Beutler Lab
Gene Symbol Ercc1
Ensembl Gene ENSMUSG00000003549
Gene Nameexcision repair cross-complementing rodent repair deficiency, complementation group 1
SynonymsErcc-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6415 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location19344778-19356524 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 19355177 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000003645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003645] [ENSMUST00000047036] [ENSMUST00000140836] [ENSMUST00000160369] [ENSMUST00000161378] [ENSMUST00000176818]
Predicted Effect probably null
Transcript: ENSMUST00000003645
SMART Domains Protein: ENSMUSP00000003645
Gene: ENSMUSG00000003549

DomainStartEndE-ValueType
low complexity region 68 79 N/A INTRINSIC
Pfam:Rad10 100 213 2.9e-55 PFAM
HhH1 269 288 4.04e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000047036
SMART Domains Protein: ENSMUSP00000044653
Gene: ENSMUSG00000047649

DomainStartEndE-ValueType
Pfam:RNA_polI_A34 37 397 7.5e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140836
SMART Domains Protein: ENSMUSP00000114443
Gene: ENSMUSG00000040734

DomainStartEndE-ValueType
coiled coil region 25 49 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150448
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160192
Predicted Effect probably benign
Transcript: ENSMUST00000160369
SMART Domains Protein: ENSMUSP00000125655
Gene: ENSMUSG00000003549

DomainStartEndE-ValueType
low complexity region 68 79 N/A INTRINSIC
Pfam:Rad10 99 166 1.6e-34 PFAM
low complexity region 232 245 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160909
Predicted Effect probably benign
Transcript: ENSMUST00000161378
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162197
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176333
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176723
Predicted Effect probably benign
Transcript: ENSMUST00000176818
SMART Domains Protein: ENSMUSP00000135767
Gene: ENSMUSG00000003549

DomainStartEndE-ValueType
Pfam:Rad10 23 90 8.4e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177486
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.1%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene functions in the nucleotide excision repair pathway, and is required for the repair of DNA lesions such as those induced by UV light or formed by electrophilic compounds including cisplatin. The encoded protein forms a heterodimer with the XPF endonuclease (also known as ERCC4), and the heterodimeric endonuclease catalyzes the 5' incision in the process of excising the DNA lesion. The heterodimeric endonuclease is also involved in recombinational DNA repair and in the repair of inter-strand crosslinks. Mutations in this gene result in cerebrooculofacioskeletal syndrome, and polymorphisms that alter expression of this gene may play a role in carcinogenesis. Multiple transcript variants encoding different isoforms have been found for this gene. The last exon of this gene overlaps with the CD3e molecule, epsilon associated protein gene on the opposite strand. [provided by RefSeq, Oct 2009]
PHENOTYPE: Nullizygous mutations result in growth and liver failure, nuclear anomalies and postnatal death, and may lead to spleen hypoplasia, altered isotype switching, B cell hypoproliferation, dystonia, ataxia, renal failure, sarcopenia, kyphosis, early replicative aging and sensitivity to oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T C 3: 88,699,972 F328L probably benign Het
4930563M21Rik G A 9: 55,974,012 T482M probably benign Het
9030624J02Rik T C 7: 118,792,646 W494R probably damaging Het
Adam9 A G 8: 24,978,482 Y513H probably damaging Het
Adamts20 C T 15: 94,324,659 probably null Het
B3gnt5 A G 16: 19,770,009 D326G probably damaging Het
Cacna1g A G 11: 94,463,417 I224T probably damaging Het
Ccdc18 A G 5: 108,161,746 I402M probably benign Het
Cckar A T 5: 53,703,056 C73S probably damaging Het
Cdk13 C T 13: 17,739,154 R880H probably damaging Het
Col1a1 A G 11: 94,940,160 N218D unknown Het
Csnk1g2 T C 10: 80,638,296 I145T possibly damaging Het
Cul5 T C 9: 53,646,683 D207G probably benign Het
Cyp2c69 A G 19: 39,842,921 F483L probably benign Het
Ddx60 A G 8: 61,983,905 D963G probably benign Het
Dhx8 G T 11: 101,737,687 A142S unknown Het
Dock7 C T 4: 98,992,448 R926Q probably damaging Het
Dscaml1 C T 9: 45,683,677 Q693* probably null Het
Dysf G A 6: 84,140,042 C1234Y probably damaging Het
Fam91a1 T C 15: 58,442,917 L549P probably damaging Het
Fxyd2 T A 9: 45,403,294 Y5N possibly damaging Het
Gab1 C A 8: 80,788,597 R364L possibly damaging Het
Gpr182 T A 10: 127,750,506 D192V possibly damaging Het
Gps1 T C 11: 120,787,722 V286A possibly damaging Het
Grk1 A G 8: 13,413,127 Y383C probably damaging Het
Hic1 G A 11: 75,166,317 P582L possibly damaging Het
Hist1h2bn T C 13: 21,754,486 Y122H probably benign Het
Igkv4-61 C A 6: 69,417,154 A31S possibly damaging Het
Lactb T C 9: 66,970,645 K301E possibly damaging Het
Lrp3 A T 7: 35,204,168 V251E probably benign Het
Mapt G A 11: 104,298,998 G265S probably benign Het
Obscn A T 11: 59,035,130 D6245E probably damaging Het
Olfr118 G T 17: 37,672,557 C178F possibly damaging Het
Olfr1257 T C 2: 89,880,862 L12P probably damaging Het
Olfr1273-ps T A 2: 90,296,037 I275F probably damaging Het
Olfr340 A G 2: 36,452,605 S7G probably damaging Het
Olfr58 T A 9: 19,783,748 I205N probably damaging Het
Olfr777 T C 10: 129,269,021 T101A probably benign Het
Olfr832 T C 9: 18,945,119 L157P probably damaging Het
Oxsm A T 14: 16,241,904 H288Q probably benign Het
Pcdh9 C T 14: 93,015,842 M1128I possibly damaging Het
Pcdha8 T C 18: 36,994,561 Y699H probably damaging Het
Pgk2 A T 17: 40,207,568 I323N probably benign Het
Plin4 A G 17: 56,103,264 V1216A probably damaging Het
Ppargc1a T C 5: 51,462,834 probably benign Het
Ppil2 A G 16: 17,103,574 probably null Het
Prelp A T 1: 133,912,778 I322N probably benign Het
Prelp A T 1: 133,914,657 I250N probably damaging Het
Prss27 T A 17: 24,042,908 C63* probably null Het
Rab38 G A 7: 88,430,540 A47T possibly damaging Het
Rprd2 G A 3: 95,774,219 A436V probably benign Het
Sacs A T 14: 61,205,359 N1618I probably damaging Het
Scp2 T G 4: 108,105,140 S63R probably benign Het
Sftpb T G 6: 72,304,649 W9G probably damaging Het
Slco1a4 A T 6: 141,834,689 L125* probably null Het
Sptlc1 T C 13: 53,351,692 probably null Het
Sub1 T A 15: 11,986,474 M96L probably benign Het
Tanc1 T C 2: 59,837,114 V1233A probably benign Het
Tmem140 A T 6: 34,872,723 D58V probably damaging Het
Tmem231 G A 8: 111,926,892 probably benign Het
Tpt1 T C 14: 75,846,371 Y91H probably benign Het
Trap1 C T 16: 4,043,992 R636H possibly damaging Het
Ttc14 A G 3: 33,803,575 H275R possibly damaging Het
Zbtb44 T A 9: 31,064,214 I380N possibly damaging Het
Zcchc6 T A 13: 59,816,296 probably null Het
Zswim5 T C 4: 116,980,866 F798L possibly damaging Het
Other mutations in Ercc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02929:Ercc1 APN 7 19355363 critical splice donor site probably null
joyless UTSW 7 19355177 splice site probably null
R2062:Ercc1 UTSW 7 19354370 makesense probably null
R4373:Ercc1 UTSW 7 19347132 unclassified probably benign
R4374:Ercc1 UTSW 7 19347132 unclassified probably benign
R4375:Ercc1 UTSW 7 19347132 unclassified probably benign
R4852:Ercc1 UTSW 7 19350704 missense probably damaging 1.00
R6000:Ercc1 UTSW 7 19347161 unclassified probably benign
X0057:Ercc1 UTSW 7 19356449 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTTCGGCAGTAAAGAGGGAC -3'
(R):5'- AAAATTCTTACCTTCTGTGGGCCC -3'

Sequencing Primer
(F):5'- GTTTCTGAAGACAGTATCTCCCCAGG -3'
(R):5'- CAGGCCCGGGCATAAGG -3'
Posted On2018-05-24