Incidental Mutation 'R6431:Adcy5'
ID518564
Institutional Source Beutler Lab
Gene Symbol Adcy5
Ensembl Gene ENSMUSG00000022840
Gene Nameadenylate cyclase 5
SynonymsAC5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R6431 (G1)
Quality Score170.009
Status Validated
Chromosome16
Chromosomal Location35154877-35305738 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35279237 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 719 (E719G)
Ref Sequence ENSEMBL: ENSMUSP00000110563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114913]
Predicted Effect probably damaging
Transcript: ENSMUST00000114913
AA Change: E719G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110563
Gene: ENSMUSG00000022840
AA Change: E719G

DomainStartEndE-ValueType
low complexity region 47 59 N/A INTRINSIC
low complexity region 75 89 N/A INTRINSIC
low complexity region 107 150 N/A INTRINSIC
low complexity region 158 175 N/A INTRINSIC
low complexity region 181 208 N/A INTRINSIC
low complexity region 243 258 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
low complexity region 305 320 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
CYCc 424 623 2.62e-69 SMART
Pfam:DUF1053 669 762 1.8e-30 PFAM
transmembrane domain 794 816 N/A INTRINSIC
transmembrane domain 837 856 N/A INTRINSIC
transmembrane domain 910 932 N/A INTRINSIC
transmembrane domain 934 956 N/A INTRINSIC
transmembrane domain 985 1004 N/A INTRINSIC
CYCc 1032 1240 2.98e-50 SMART
Meta Mutation Damage Score 0.454 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 93.9%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-bound adenylyl cyclase enzymes. Adenylyl cyclases mediate G protein-coupled receptor signaling through the synthesis of the second messenger cAMP. Activity of the encoded protein is stimulated by the Gs alpha subunit of G protein-coupled receptors and is inhibited by protein kinase A, calcium and Gi alpha subunits. Single nucleotide polymorphisms in this gene may be associated with low birth weight and type 2 diabetes. Alternatively spliced transcript variants that encode different isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Targeted inactivation of this gene has been shown to result in motor dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik T A 1: 26,684,030 N690Y probably benign Het
Ankdd1a A G 9: 65,516,938 M31T possibly damaging Het
Atp13a5 T C 16: 29,251,402 K911E possibly damaging Het
Bpifb3 G T 2: 153,924,808 L210F probably damaging Het
Cacna1c T C 6: 118,751,373 Y211C probably damaging Het
Carm1 C A 9: 21,583,077 P297T probably damaging Het
Cdh19 A T 1: 110,925,057 Y383N probably benign Het
Cfap221 T C 1: 119,932,853 H681R probably damaging Het
Cmya5 A C 13: 93,074,464 S3274A possibly damaging Het
Cndp2 T A 18: 84,675,078 K186* probably null Het
Ctdp1 G T 18: 80,451,255 F310L probably damaging Het
Cyp2c55 A T 19: 39,031,409 I264F probably damaging Het
Dhx40 A T 11: 86,773,823 F628I probably damaging Het
Disc1 T A 8: 125,135,389 M500K possibly damaging Het
Dnah5 A C 15: 28,349,824 D2551A possibly damaging Het
Esyt1 A G 10: 128,516,674 probably null Het
Fam78a T C 2: 32,082,831 S26G probably damaging Het
Fn1 G A 1: 71,647,844 probably null Het
Gbx1 T C 5: 24,504,918 T310A probably benign Het
Ggh T A 4: 20,042,219 C16S unknown Het
Gm11595 T A 11: 99,772,774 T27S unknown Het
Gm17334 T A 11: 53,772,738 probably benign Het
Gsk3b A G 16: 38,193,949 I256M probably damaging Het
Hmcn1 A T 1: 150,744,960 S1166R probably benign Het
Hyou1 T C 9: 44,382,025 probably null Het
Jup G T 11: 100,374,341 R637S probably benign Het
Lama2 T A 10: 27,053,031 I2087F possibly damaging Het
Lamc1 T G 1: 153,221,671 K1542N probably benign Het
Lgals4 G T 7: 28,840,692 Het
Lrrc8d A G 5: 105,811,760 D12G probably damaging Het
Lrwd1 C T 5: 136,133,034 V207M possibly damaging Het
Mbd1 T A 18: 74,273,691 probably null Het
Msi1 T A 5: 115,450,925 I333N probably damaging Het
Neo1 C T 9: 58,907,071 V871I probably benign Het
Nr2c1 T C 10: 94,188,216 C428R probably damaging Het
Ntm A G 9: 29,411,682 L14P probably damaging Het
Nxpe4 A T 9: 48,392,845 K77N probably damaging Het
Olfr1049 G A 2: 86,255,358 L112F probably benign Het
Olfr1224-ps1 T A 2: 89,157,161 S5C probably damaging Het
Olfr1293-ps T A 2: 111,527,656 M132K probably damaging Het
Olfr406 A C 11: 74,269,409 T7P possibly damaging Het
Olfr948 T C 9: 39,318,778 T279A possibly damaging Het
Pappa T A 4: 65,156,464 D418E probably damaging Het
Pde4d G A 13: 109,601,786 probably null Het
Pip A G 6: 41,851,457 N75S possibly damaging Het
Plcl1 G C 1: 55,697,252 R584P probably benign Het
Pnp A T 14: 50,951,014 D237V probably damaging Het
Ppp1r12a T C 10: 108,262,420 W857R probably damaging Het
Pramef12 T C 4: 144,393,083 T305A possibly damaging Het
Ptchd3 A T 11: 121,836,403 M368L probably benign Het
Pum1 T A 4: 130,774,505 S868R probably damaging Het
R3hdml A T 2: 163,502,404 S238C probably damaging Het
Robo2 G A 16: 74,046,809 R173* probably null Het
Sall3 A G 18: 80,973,187 S509P possibly damaging Het
Sap130 T G 18: 31,666,365 H298Q possibly damaging Het
Selenov C A 7: 28,288,033 G307C probably damaging Het
Setd2 T A 9: 110,550,385 H1089Q possibly damaging Het
Setdb2 T C 14: 59,419,056 N287D probably damaging Het
Sis C T 3: 72,958,174 V182I probably benign Het
Slc32a1 A C 2: 158,611,537 D99A probably benign Het
Slk A G 19: 47,620,888 D760G probably damaging Het
Smg5 T A 3: 88,351,220 D499E probably benign Het
Stat3 T C 11: 100,889,574 T720A possibly damaging Het
Trdn T G 10: 33,139,114 N21K probably damaging Het
Trpm4 A T 7: 45,326,568 V118E possibly damaging Het
Vgll3 A G 16: 65,815,754 Q41R probably damaging Het
Vmn1r189 A G 13: 22,102,355 V104A probably damaging Het
Vmn1r46 A T 6: 89,976,407 R79S probably benign Het
Zscan4c T C 7: 11,006,929 M125T probably benign Het
Other mutations in Adcy5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Adcy5 APN 16 35253213 missense possibly damaging 0.49
IGL01583:Adcy5 APN 16 35283513 splice site probably benign
IGL01608:Adcy5 APN 16 35272165 missense probably damaging 1.00
IGL02097:Adcy5 APN 16 35272098 missense probably damaging 1.00
IGL02122:Adcy5 APN 16 35283612 splice site probably benign
IGL02532:Adcy5 APN 16 35272083 missense possibly damaging 0.79
IGL02814:Adcy5 APN 16 35303649 missense probably benign 0.08
IGL02877:Adcy5 APN 16 35298600 missense probably damaging 1.00
IGL03026:Adcy5 APN 16 35157042 missense probably benign 0.41
IGL03345:Adcy5 APN 16 35248814 missense probably benign 0.05
H8562:Adcy5 UTSW 16 35267181 missense probably damaging 1.00
H8786:Adcy5 UTSW 16 35267181 missense probably damaging 1.00
R0050:Adcy5 UTSW 16 35304303 utr 3 prime probably benign
R0091:Adcy5 UTSW 16 35270998 critical splice donor site probably null
R0112:Adcy5 UTSW 16 35156178 missense possibly damaging 0.85
R0398:Adcy5 UTSW 16 35269068 missense probably damaging 1.00
R0457:Adcy5 UTSW 16 35274545 missense probably benign 0.07
R0554:Adcy5 UTSW 16 35294017 missense probably benign 0.26
R0698:Adcy5 UTSW 16 35290082 missense possibly damaging 0.78
R0761:Adcy5 UTSW 16 35270825 splice site probably benign
R0865:Adcy5 UTSW 16 35274471 missense probably damaging 0.96
R0927:Adcy5 UTSW 16 35156243 missense probably benign 0.32
R0945:Adcy5 UTSW 16 35290111 missense probably benign
R1534:Adcy5 UTSW 16 35253259 missense possibly damaging 0.92
R1565:Adcy5 UTSW 16 35268957 missense probably damaging 1.00
R1721:Adcy5 UTSW 16 35298424 missense probably damaging 1.00
R1839:Adcy5 UTSW 16 35248940 missense probably damaging 1.00
R2047:Adcy5 UTSW 16 35290108 missense possibly damaging 0.78
R3052:Adcy5 UTSW 16 35303716 missense probably damaging 1.00
R3053:Adcy5 UTSW 16 35303716 missense probably damaging 1.00
R3827:Adcy5 UTSW 16 35290097 missense probably benign 0.03
R4398:Adcy5 UTSW 16 35268993 missense probably damaging 1.00
R4700:Adcy5 UTSW 16 35279216 missense possibly damaging 0.49
R4965:Adcy5 UTSW 16 35278502 missense possibly damaging 0.82
R5229:Adcy5 UTSW 16 35269070 missense probably damaging 0.99
R5456:Adcy5 UTSW 16 35298522 missense probably damaging 1.00
R5586:Adcy5 UTSW 16 35157116 missense probably damaging 0.99
R5757:Adcy5 UTSW 16 35272081 missense probably damaging 1.00
R5959:Adcy5 UTSW 16 35298410 missense probably damaging 1.00
R6011:Adcy5 UTSW 16 35157228 missense probably benign 0.05
R6277:Adcy5 UTSW 16 35289526 missense probably benign 0.02
R6296:Adcy5 UTSW 16 35303710 missense probably damaging 1.00
R6379:Adcy5 UTSW 16 35293999 missense probably benign 0.13
R6685:Adcy5 UTSW 16 35279216 missense possibly damaging 0.49
R6728:Adcy5 UTSW 16 35157165 missense possibly damaging 0.88
R6755:Adcy5 UTSW 16 35303634 missense possibly damaging 0.95
R6887:Adcy5 UTSW 16 35298590 missense possibly damaging 0.74
R7029:Adcy5 UTSW 16 35299648 missense probably null 0.91
R7047:Adcy5 UTSW 16 35267215 missense probably damaging 1.00
R7050:Adcy5 UTSW 16 35303700 missense possibly damaging 0.88
R7102:Adcy5 UTSW 16 35299625 missense probably damaging 1.00
R7150:Adcy5 UTSW 16 35298534 missense probably damaging 1.00
R7242:Adcy5 UTSW 16 35156835 missense probably damaging 1.00
R7387:Adcy5 UTSW 16 35272090 missense probably damaging 1.00
V7732:Adcy5 UTSW 16 35283541 missense probably benign 0.00
X0022:Adcy5 UTSW 16 35299456 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CGGTCATGTGCAGTTGTTAAGAAC -3'
(R):5'- AGAGAGGAAGTCACCCTGTG -3'

Sequencing Primer
(F):5'- CAGTTGTTAAGAACACAGCCTGGTC -3'
(R):5'- CTGTGGGCTGCCCTCTATG -3'
Posted On2018-05-24