Incidental Mutation 'R7718:Adcy5'
ID595066
Institutional Source Beutler Lab
Gene Symbol Adcy5
Ensembl Gene ENSMUSG00000022840
Gene Nameadenylate cyclase 5
SynonymsAC5
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R7718 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location35154877-35305738 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35280415 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 779 (V779A)
Ref Sequence ENSEMBL: ENSMUSP00000110563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114913]
Predicted Effect probably benign
Transcript: ENSMUST00000114913
AA Change: V779A

PolyPhen 2 Score 0.421 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000110563
Gene: ENSMUSG00000022840
AA Change: V779A

DomainStartEndE-ValueType
low complexity region 47 59 N/A INTRINSIC
low complexity region 75 89 N/A INTRINSIC
low complexity region 107 150 N/A INTRINSIC
low complexity region 158 175 N/A INTRINSIC
low complexity region 181 208 N/A INTRINSIC
low complexity region 243 258 N/A INTRINSIC
low complexity region 269 288 N/A INTRINSIC
low complexity region 305 320 N/A INTRINSIC
low complexity region 350 368 N/A INTRINSIC
CYCc 424 623 2.62e-69 SMART
Pfam:DUF1053 669 762 1.8e-30 PFAM
transmembrane domain 794 816 N/A INTRINSIC
transmembrane domain 837 856 N/A INTRINSIC
transmembrane domain 910 932 N/A INTRINSIC
transmembrane domain 934 956 N/A INTRINSIC
transmembrane domain 985 1004 N/A INTRINSIC
CYCc 1032 1240 2.98e-50 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-bound adenylyl cyclase enzymes. Adenylyl cyclases mediate G protein-coupled receptor signaling through the synthesis of the second messenger cAMP. Activity of the encoded protein is stimulated by the Gs alpha subunit of G protein-coupled receptors and is inhibited by protein kinase A, calcium and Gi alpha subunits. Single nucleotide polymorphisms in this gene may be associated with low birth weight and type 2 diabetes. Alternatively spliced transcript variants that encode different isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Targeted inactivation of this gene has been shown to result in motor dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T C 7: 28,147,201 F1106S probably damaging Het
A430033K04Rik A T 5: 138,647,860 H669L possibly damaging Het
A930017K11Rik T A 17: 25,947,024 R430* probably null Het
Abcb1a A T 5: 8,715,788 N700I probably damaging Het
Abcc6 T C 7: 45,977,392 K1414E possibly damaging Het
Agap2 A G 10: 127,079,865 S82G possibly damaging Het
Aldh1l1 A G 6: 90,598,323 N864S probably damaging Het
Ang2 A T 14: 51,195,760 V55E probably benign Het
Ank2 A G 3: 126,965,013 M179T possibly damaging Het
Atrnl1 T A 19: 57,740,183 C1090* probably null Het
Atxn1l A G 8: 109,733,234 L132P probably damaging Het
Bptf A G 11: 107,081,456 V862A possibly damaging Het
Capn11 C A 17: 45,643,781 K143N probably damaging Het
Card6 A G 15: 5,099,787 V709A possibly damaging Het
Cavin4 C T 4: 48,671,984 A143V probably benign Het
Cntn5 A G 9: 9,984,128 I160T probably benign Het
Cyp2c40 T A 19: 39,767,338 N511Y probably benign Het
Dsc2 A T 18: 20,041,778 I480N probably damaging Het
Enoph1 T C 5: 100,062,160 V133A possibly damaging Het
Ezh2 A T 6: 47,554,191 D186E probably benign Het
Fam196b T C 11: 34,402,539 S194P probably benign Het
Gfra1 T C 19: 58,453,457 D14G possibly damaging Het
Gm9573 T C 17: 35,622,836 T153A unknown Het
Gmip C T 8: 69,817,733 R698W probably damaging Het
Grk4 A G 5: 34,694,816 N135D probably benign Het
Hspb6 A G 7: 30,554,347 D95G probably benign Het
Htatip2 T G 7: 49,770,884 H159Q possibly damaging Het
Igfn1 T C 1: 135,969,036 E1264G probably benign Het
Katnb1 T A 8: 95,095,208 V223E possibly damaging Het
Klra6 AGG AG 6: 130,013,352 probably null Het
Masp2 C T 4: 148,602,747 R29C probably damaging Het
Mcm3 A T 1: 20,817,274 C123* probably null Het
Mdn1 T C 4: 32,718,420 V2225A probably damaging Het
Me1 A G 9: 86,679,900 L44S probably damaging Het
Mlxip A G 5: 123,445,514 N380S probably benign Het
Myh14 C T 7: 44,661,040 V140I probably damaging Het
Myocd A T 11: 65,218,626 D106E probably damaging Het
Oat T C 7: 132,558,259 I411V probably benign Het
Olfr1085 A G 2: 86,658,029 V143A probably benign Het
Olfr483 T C 7: 108,103,648 V113A probably benign Het
Olfr715 A T 7: 107,128,718 V225D probably damaging Het
Orc2 A T 1: 58,480,317 H246Q possibly damaging Het
Pank4 A G 4: 154,974,643 E411G probably damaging Het
Pcdhb15 A G 18: 37,475,163 N483D probably damaging Het
Pcdhb20 A G 18: 37,505,651 D410G probably damaging Het
Pdcl2 A G 5: 76,317,999 C125R probably damaging Het
Peli3 C G 19: 4,934,556 probably null Het
Pkd1 A G 17: 24,586,500 D3313G probably benign Het
Plec A C 15: 76,177,439 M2766R probably damaging Het
Ppargc1a C T 5: 51,498,162 V99M probably damaging Het
Psg19 G A 7: 18,792,443 A374V probably benign Het
Psmd7 A T 8: 107,586,629 F54L possibly damaging Het
Ptbp2 C T 3: 119,720,988 G397R probably null Het
Ranbp3 A G 17: 56,696,718 D39G probably damaging Het
Rcor3 T C 1: 192,101,721 T406A probably benign Het
Rhbdl2 T A 4: 123,824,919 I222K probably damaging Het
Ripk2 T C 4: 16,151,968 N197S possibly damaging Het
Rpia A T 6: 70,766,618 M283K probably damaging Het
Rps6kc1 T C 1: 190,871,825 D200G probably benign Het
Sipa1l1 A T 12: 82,342,497 K499M probably damaging Het
Slc5a4b A G 10: 76,070,573 L404P probably damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
St7 A C 6: 17,854,999 T312P probably damaging Het
Strbp T C 2: 37,625,282 E244G probably damaging Het
Tbc1d8 T G 1: 39,376,980 T871P probably benign Het
Tcp1 T A 17: 12,922,162 I286N probably damaging Het
Tead3 C A 17: 28,333,517 V327F probably damaging Het
Tmem132c A T 5: 127,563,440 T892S probably benign Het
Trmt2a T C 16: 18,250,623 S65P probably benign Het
Ubp1 A G 9: 113,973,529 N479S possibly damaging Het
Ubtfl1 A T 9: 18,409,231 L18F possibly damaging Het
Uevld T G 7: 46,938,056 M299L probably benign Het
Unc13b T A 4: 43,173,854 Y1561N unknown Het
Ylpm1 A G 12: 85,029,122 K874E probably damaging Het
Zbtb37 G A 1: 161,032,232 R168W possibly damaging Het
Other mutations in Adcy5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Adcy5 APN 16 35253213 missense possibly damaging 0.49
IGL01583:Adcy5 APN 16 35283513 splice site probably benign
IGL01608:Adcy5 APN 16 35272165 missense probably damaging 1.00
IGL02097:Adcy5 APN 16 35272098 missense probably damaging 1.00
IGL02122:Adcy5 APN 16 35283612 splice site probably benign
IGL02532:Adcy5 APN 16 35272083 missense possibly damaging 0.79
IGL02814:Adcy5 APN 16 35303649 missense probably benign 0.08
IGL02877:Adcy5 APN 16 35298600 missense probably damaging 1.00
IGL03026:Adcy5 APN 16 35157042 missense probably benign 0.41
IGL03345:Adcy5 APN 16 35248814 missense probably benign 0.05
H8562:Adcy5 UTSW 16 35267181 missense probably damaging 1.00
H8786:Adcy5 UTSW 16 35267181 missense probably damaging 1.00
R0050:Adcy5 UTSW 16 35304303 utr 3 prime probably benign
R0091:Adcy5 UTSW 16 35270998 critical splice donor site probably null
R0112:Adcy5 UTSW 16 35156178 missense possibly damaging 0.85
R0398:Adcy5 UTSW 16 35269068 missense probably damaging 1.00
R0457:Adcy5 UTSW 16 35274545 missense probably benign 0.07
R0554:Adcy5 UTSW 16 35294017 missense probably benign 0.26
R0698:Adcy5 UTSW 16 35290082 missense possibly damaging 0.78
R0761:Adcy5 UTSW 16 35270825 splice site probably benign
R0865:Adcy5 UTSW 16 35274471 missense probably damaging 0.96
R0927:Adcy5 UTSW 16 35156243 missense probably benign 0.32
R0945:Adcy5 UTSW 16 35290111 missense probably benign
R1534:Adcy5 UTSW 16 35253259 missense possibly damaging 0.92
R1565:Adcy5 UTSW 16 35268957 missense probably damaging 1.00
R1721:Adcy5 UTSW 16 35298424 missense probably damaging 1.00
R1839:Adcy5 UTSW 16 35248940 missense probably damaging 1.00
R2047:Adcy5 UTSW 16 35290108 missense possibly damaging 0.78
R3052:Adcy5 UTSW 16 35303716 missense probably damaging 1.00
R3053:Adcy5 UTSW 16 35303716 missense probably damaging 1.00
R3827:Adcy5 UTSW 16 35290097 missense probably benign 0.03
R4398:Adcy5 UTSW 16 35268993 missense probably damaging 1.00
R4700:Adcy5 UTSW 16 35279216 missense possibly damaging 0.49
R4965:Adcy5 UTSW 16 35278502 missense possibly damaging 0.82
R5229:Adcy5 UTSW 16 35269070 missense probably damaging 0.99
R5456:Adcy5 UTSW 16 35298522 missense probably damaging 1.00
R5586:Adcy5 UTSW 16 35157116 missense probably damaging 0.99
R5757:Adcy5 UTSW 16 35272081 missense probably damaging 1.00
R5959:Adcy5 UTSW 16 35298410 missense probably damaging 1.00
R6011:Adcy5 UTSW 16 35157228 missense probably benign 0.05
R6277:Adcy5 UTSW 16 35289526 missense probably benign 0.02
R6296:Adcy5 UTSW 16 35303710 missense probably damaging 1.00
R6379:Adcy5 UTSW 16 35293999 missense probably benign 0.13
R6431:Adcy5 UTSW 16 35279237 missense probably damaging 1.00
R6685:Adcy5 UTSW 16 35279216 missense possibly damaging 0.49
R6728:Adcy5 UTSW 16 35157165 missense possibly damaging 0.88
R6755:Adcy5 UTSW 16 35303634 missense possibly damaging 0.95
R6887:Adcy5 UTSW 16 35298590 missense possibly damaging 0.74
R7029:Adcy5 UTSW 16 35299648 missense probably null 0.91
R7047:Adcy5 UTSW 16 35267215 missense probably damaging 1.00
R7050:Adcy5 UTSW 16 35303700 missense possibly damaging 0.88
R7102:Adcy5 UTSW 16 35299625 missense probably damaging 1.00
R7150:Adcy5 UTSW 16 35298534 missense probably damaging 1.00
R7242:Adcy5 UTSW 16 35156835 missense probably damaging 1.00
R7387:Adcy5 UTSW 16 35272090 missense probably damaging 1.00
R7654:Adcy5 UTSW 16 35270947 missense probably damaging 1.00
R7834:Adcy5 UTSW 16 35157200 missense probably benign 0.03
R7917:Adcy5 UTSW 16 35157200 missense probably benign 0.03
V7732:Adcy5 UTSW 16 35283541 missense probably benign 0.00
X0022:Adcy5 UTSW 16 35299456 missense probably damaging 0.99
Z1176:Adcy5 UTSW 16 35156321 missense unknown
Z1176:Adcy5 UTSW 16 35290185 missense probably benign 0.03
Z1176:Adcy5 UTSW 16 35291544 missense not run
Z1177:Adcy5 UTSW 16 35291544 missense not run
Predicted Primers PCR Primer
(F):5'- TCTGTGTAAGCCCAGCTCTG -3'
(R):5'- AGGAGTCTCTTGTGCAACTG -3'

Sequencing Primer
(F):5'- AGCTCTGGTCTCCATGTGTCATG -3'
(R):5'- CTGAGAATTGCCCAGTGAGGTC -3'
Posted On2019-11-12