Mutagenetix > Incidental Mutations

Incidental Mutation 'R6537:Anapc4'

520470

Institutional Source

Beutler Lab

Gene Symbol

Anapc4

Ensembl Gene

ENSMUSG00000029176

Gene Name

anaphase promoting complex subunit 4

Synonyms

2610306D21Rik, D5Ertd249e, APC4

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6537 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

52834012-52867797 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 52843556 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 224 (S224P)

Ref Sequence

ENSEMBL: ENSMUSP00000031072 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031072] [ENSMUST00000144574]

Predicted Effect

probably damaging
Transcript: ENSMUST00000031072
AA Change: S224P

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000031072
Gene: ENSMUSG00000029176
AA Change: S224P

Domain	Start	End	E-Value	Type
Pfam:ANAPC4_WD40	10	57	9.1e-18	PFAM
low complexity region	137	147	N/A	INTRINSIC
Pfam:ANAPC4	232	431	3.7e-61	PFAM
low complexity region	747	763	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130536

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141641

Predicted Effect

probably benign
Transcript: ENSMUST00000144574

SMART Domains

Protein: ENSMUSP00000114475
Gene: ENSMUSG00000029176

Domain	Start	End	E-Value	Type
Pfam:Apc4_WD40	10	57	4e-20	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000150682
AA Change: S45P

Predicted Effect

unknown
Transcript: ENSMUST00000198207
AA Change: S49P

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

100% (30/30)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A large protein complex, termed the anaphase-promoting complex (APC), or the cyclosome, promotes metaphase-anaphase transition by ubiquitinating its specific substrates such as mitotic cyclins and anaphase inhibitor, which are subsequently degraded by the 26S proteasome. Biochemical studies have shown that the vertebrate APC contains eight subunits. The composition of the APC is highly conserved in organisms from yeast to humans. The exact function of this gene product is not known. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Col6a4	G	A	9: 106,067,954	T987M	possibly damaging	Het
Cort	C	T	4: 149,126,624	G8E	probably benign	Het
Ctdp1	G	T	18: 80,449,551	D576E	probably benign	Het
Ctsq	A	T	13: 61,035,326	I334N	probably damaging	Het
Cwc15	A	G	9: 14,501,988	D22G	probably damaging	Het
Dnmt3l	G	A	10: 78,052,064	G136R	probably null	Het
Fam19a2	T	A	10: 123,593,496	M5K	possibly damaging	Het
Fxyd6	A	G	9: 45,390,794	I37V	possibly damaging	Het
Gm10604	A	C	4: 11,980,221	S28A	unknown	Het
Gm43302	A	G	5: 105,290,995	I9T	possibly damaging	Het
Hmcn2	T	C	2: 31,415,268	V3151A	probably benign	Het
Kif1b	T	C	4: 149,192,596	M1337V	probably benign	Het
Kyat3	A	G	3: 142,729,812	T282A	probably benign	Het
Lrp6	T	C	6: 134,480,495	E782G	probably benign	Het
Lrrc3b	T	C	14: 15,357,946	Y220C	probably damaging	Het
Macf1	C	T	4: 123,492,725	S1033N	probably damaging	Het
Mdm1	A	G	10: 118,158,576	T452A	probably benign	Het
Nrn1l	G	T	8: 105,894,718	R99L	probably damaging	Het
Pappa	T	A	4: 65,297,282	I1142N	probably damaging	Het
Pcsk1	T	C	13: 75,132,239	F728L	probably damaging	Het
Ptcd3	T	C	6: 71,897,110		probably null	Het
Siglecf	C	T	7: 43,355,999	T461I	probably benign	Het
Slc7a8	C	T	14: 54,735,119	A282T	probably benign	Het
Srcap	T	C	7: 127,542,220	V1724A	probably damaging	Het
Tek	A	G	4: 94,837,324	Q609R	probably benign	Het
Trim45	C	T	3: 100,925,396	A315V	probably benign	Het
Ttbk1	C	T	17: 46,470,310	V446M	probably damaging	Het
Wrap53	T	C	11: 69,563,868	D225G	possibly damaging	Het
Znhit6	A	G	3: 145,594,619	I193V	probably benign	Het

Other mutations in Anapc4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00801:Anapc4	APN	5	52857211	missense	probably damaging	0.98
IGL01066:Anapc4	APN	5	52857209	missense	probably benign	0.08
IGL01109:Anapc4	APN	5	52848628	missense	probably damaging	1.00
IGL01657:Anapc4	APN	5	52864626	nonsense	probably null
IGL02692:Anapc4	APN	5	52864529	missense	probably damaging	0.98
IGL02734:Anapc4	APN	5	52861291	missense	probably benign	0.04
IGL03089:Anapc4	APN	5	52866398	missense	probably benign	0.32
IGL03096:Anapc4	APN	5	52865929	missense	possibly damaging	0.57
FR4304:Anapc4	UTSW	5	52864526	missense	probably damaging	1.00
IGL03048:Anapc4	UTSW	5	52839733	missense	probably benign	0.00
R0331:Anapc4	UTSW	5	52855642	splice site	probably benign
R0511:Anapc4	UTSW	5	52842017	unclassified	probably benign
R0624:Anapc4	UTSW	5	52845419	splice site	probably benign
R0919:Anapc4	UTSW	5	52855637	missense	probably benign	0.18
R1935:Anapc4	UTSW	5	52839668	missense	probably damaging	0.99
R1936:Anapc4	UTSW	5	52839668	missense	probably damaging	0.99
R1942:Anapc4	UTSW	5	52846714	missense	probably benign	0.30
R1953:Anapc4	UTSW	5	52839688	missense	probably damaging	1.00
R1954:Anapc4	UTSW	5	52846625	intron	probably benign
R2341:Anapc4	UTSW	5	52841937	unclassified	probably benign
R3696:Anapc4	UTSW	5	52862009	missense	probably null	0.01
R4506:Anapc4	UTSW	5	52835730	missense	possibly damaging	0.79
R4596:Anapc4	UTSW	5	52841718	missense	probably benign	0.00
R5234:Anapc4	UTSW	5	52848776	missense	probably damaging	1.00
R5256:Anapc4	UTSW	5	52863594	missense	probably benign
R5310:Anapc4	UTSW	5	52859159	missense	probably benign	0.00
R5401:Anapc4	UTSW	5	52863649	missense	probably benign	0.01
R5409:Anapc4	UTSW	5	52848599	missense	probably damaging	0.98
R5525:Anapc4	UTSW	5	52856809	missense	probably damaging	1.00
R5575:Anapc4	UTSW	5	52855871	missense	probably damaging	1.00
R5604:Anapc4	UTSW	5	52841734	nonsense	probably null
R5695:Anapc4	UTSW	5	52862239	missense	probably benign	0.00
R5955:Anapc4	UTSW	5	52865946	missense	probably benign	0.01
R5974:Anapc4	UTSW	5	52845400	missense	probably damaging	1.00
R6458:Anapc4	UTSW	5	52864553	missense	possibly damaging	0.80
R6633:Anapc4	UTSW	5	52865946	missense	possibly damaging	0.85
R6860:Anapc4	UTSW	5	52848828	missense	probably damaging	1.00
R6965:Anapc4	UTSW	5	52835751	missense	possibly damaging	0.89
R7067:Anapc4	UTSW	5	52862235	missense	probably benign
R7327:Anapc4	UTSW	5	52845330	missense	probably damaging	0.99
R7442:Anapc4	UTSW	5	52857201	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- GGAATCAGGGTTGTGCATTTCTAC -3'
(R):5'- ACATCCCAAGGAGACCTTCATG -3'

Sequencing Primer
(F):5'- GGGTTGTGCATTTCTACTTTTTAAAG -3'
(R):5'- CCAAGGAGACCTTCATGTTTTAC -3'

Posted On

2018-06-06