Incidental Mutation 'R6516:Deup1'
ID520715
Institutional Source Beutler Lab
Gene Symbol Deup1
Ensembl Gene ENSMUSG00000039977
Gene Namedeuterosome assembly protein 1
SynonymsCcdc67, 4933401K09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6516 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location15559864-15627933 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 15610614 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 85 (M85R)
Ref Sequence ENSEMBL: ENSMUSP00000111256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045513] [ENSMUST00000115592] [ENSMUST00000115593] [ENSMUST00000152377]
Predicted Effect probably damaging
Transcript: ENSMUST00000045513
AA Change: M85R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000039912
Gene: ENSMUSG00000039977
AA Change: M85R

DomainStartEndE-ValueType
Pfam:CEP63 11 279 7.7e-92 PFAM
low complexity region 286 299 N/A INTRINSIC
coiled coil region 353 397 N/A INTRINSIC
coiled coil region 555 586 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115592
AA Change: M85R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111255
Gene: ENSMUSG00000039977
AA Change: M85R

DomainStartEndE-ValueType
coiled coil region 29 59 N/A INTRINSIC
coiled coil region 166 196 N/A INTRINSIC
coiled coil region 226 277 N/A INTRINSIC
low complexity region 286 299 N/A INTRINSIC
coiled coil region 461 492 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115593
AA Change: M85R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111256
Gene: ENSMUSG00000039977
AA Change: M85R

DomainStartEndE-ValueType
coiled coil region 29 59 N/A INTRINSIC
coiled coil region 166 196 N/A INTRINSIC
coiled coil region 226 277 N/A INTRINSIC
low complexity region 286 299 N/A INTRINSIC
coiled coil region 461 492 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152377
AA Change: M85R

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000121526
Gene: ENSMUSG00000039977
AA Change: M85R

DomainStartEndE-ValueType
coiled coil region 29 59 N/A INTRINSIC
coiled coil region 166 196 N/A INTRINSIC
coiled coil region 226 277 N/A INTRINSIC
low complexity region 286 299 N/A INTRINSIC
coiled coil region 353 397 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (63/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930558K02Rik A T 1: 161,952,666 V93E probably benign Het
Adam18 A G 8: 24,674,687 L4P probably damaging Het
Adcy8 A T 15: 64,699,387 Y1136N probably damaging Het
Adgrl3 A G 5: 81,465,272 Y184C probably damaging Het
Ankrd6 G A 4: 32,836,427 R43W probably damaging Het
Ano8 G T 8: 71,481,780 probably null Het
Arhgap31 A G 16: 38,609,404 F370L possibly damaging Het
C7 A G 15: 5,057,081 V26A probably damaging Het
Clec4a2 C A 6: 123,139,406 Q153K probably damaging Het
Cyp2c67 T A 19: 39,617,429 D341V probably damaging Het
Ddo T A 10: 40,631,745 V46E probably damaging Het
Dmxl2 A T 9: 54,416,676 S1141R probably damaging Het
Dnah2 A G 11: 69,465,386 F2147L probably benign Het
Dock10 T C 1: 80,540,461 E1298G probably damaging Het
Dock4 T A 12: 40,731,899 V701E possibly damaging Het
Dthd1 A T 5: 62,839,264 K447N probably benign Het
Eno2 G T 6: 124,761,709 probably null Het
Fastkd5 T A 2: 130,614,301 T790S possibly damaging Het
Fer1l4 C T 2: 156,035,199 V1139M probably damaging Het
Gm10020 A G 15: 52,477,804 noncoding transcript Het
Gpbp1 A T 13: 111,453,102 H111Q probably benign Het
Grk3 A T 5: 112,961,549 probably benign Het
Itpr3 C T 17: 27,091,370 A403V probably benign Het
Kcnc2 A G 10: 112,462,000 T610A probably benign Het
Kcnh1 T A 1: 192,418,781 D560E possibly damaging Het
Klc4 A T 17: 46,642,255 N116K probably damaging Het
Krba1 C T 6: 48,413,272 Q656* probably null Het
Mchr1 A G 15: 81,237,868 Y273C probably damaging Het
Myh15 T A 16: 49,137,633 C938S probably benign Het
Nutm1 T C 2: 112,251,217 E367G probably damaging Het
Odf3 G A 7: 140,848,805 G128S probably damaging Het
Olfr1143 A T 2: 87,802,770 Y127F possibly damaging Het
Olfr1509 A T 14: 52,451,129 T239S probably damaging Het
Olfr519 A T 7: 108,893,765 I214K probably damaging Het
Olfr912 A G 9: 38,581,472 N65S probably damaging Het
Pikfyve G T 1: 65,265,781 M1697I probably benign Het
Plcd1 A G 9: 119,076,203 S147P probably damaging Het
Plin3 G A 17: 56,286,223 P113L probably damaging Het
Pum3 C A 19: 27,426,008 S31I probably benign Het
Robo1 T C 16: 73,024,353 V1327A probably benign Het
Rpl34 G A 3: 130,729,067 P50L probably benign Het
Scnn1b T C 7: 121,912,112 S341P probably damaging Het
Sh3bp5 A T 14: 31,375,672 M362K possibly damaging Het
Slc24a5 A G 2: 125,088,107 T443A probably benign Het
Slc25a12 T C 2: 71,324,083 Y81C probably damaging Het
Slc43a3 A G 2: 84,957,761 T496A probably benign Het
Smap2 C T 4: 120,983,106 probably null Het
Sptbn5 T A 2: 120,047,950 probably benign Het
Taar5 A G 10: 23,971,666 S321G possibly damaging Het
Tbx21 T C 11: 97,099,956 I299V possibly damaging Het
Tcerg1 T C 18: 42,530,892 probably null Het
Tenm3 G C 8: 48,417,222 Q179E probably benign Het
Tmem176a T G 6: 48,844,068 probably null Het
Tmem236 T C 2: 14,195,980 S119P probably benign Het
Tmprss11a C T 5: 86,420,128 V247M probably damaging Het
Tnks1bp1 T C 2: 85,070,727 S1593P probably damaging Het
Ttc9b T A 7: 27,655,987 D227E probably benign Het
Usp33 A C 3: 152,373,416 Q435P probably benign Het
Vti1a C T 19: 55,380,958 A94V probably damaging Het
Wdr3 A G 3: 100,145,676 Y587H probably damaging Het
Wwc1 G A 11: 35,867,302 A739V probably benign Het
Zfp628 C G 7: 4,920,202 Y474* probably null Het
Zfp820 A T 17: 21,819,373 C325S probably damaging Het
Other mutations in Deup1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Deup1 APN 9 15561370 missense probably damaging 0.96
IGL00927:Deup1 APN 9 15610671 splice site probably benign
IGL00946:Deup1 APN 9 15561238 missense possibly damaging 0.62
IGL02458:Deup1 APN 9 15592360 missense probably benign 0.02
IGL02567:Deup1 APN 9 15575283 missense probably damaging 1.00
IGL03089:Deup1 APN 9 15607800 missense possibly damaging 0.62
IGL03220:Deup1 APN 9 15592411 missense probably benign 0.38
IGL03147:Deup1 UTSW 9 15610614 missense probably damaging 0.99
PIT4468001:Deup1 UTSW 9 15564005 missense possibly damaging 0.79
R0035:Deup1 UTSW 9 15599821 missense possibly damaging 0.89
R0035:Deup1 UTSW 9 15599821 missense possibly damaging 0.89
R0324:Deup1 UTSW 9 15582533 missense probably benign 0.01
R0539:Deup1 UTSW 9 15582597 missense possibly damaging 0.51
R0835:Deup1 UTSW 9 15599751 missense probably damaging 1.00
R1666:Deup1 UTSW 9 15575191 missense possibly damaging 0.92
R2212:Deup1 UTSW 9 15599843 missense probably benign 0.00
R2237:Deup1 UTSW 9 15575301 missense probably damaging 1.00
R2238:Deup1 UTSW 9 15575301 missense probably damaging 1.00
R2423:Deup1 UTSW 9 15592458 nonsense probably null
R2929:Deup1 UTSW 9 15575188 missense probably benign 0.03
R3890:Deup1 UTSW 9 15599713 missense probably damaging 1.00
R3892:Deup1 UTSW 9 15599713 missense probably damaging 1.00
R4941:Deup1 UTSW 9 15588027 missense probably benign
R4959:Deup1 UTSW 9 15612014 nonsense probably null
R4960:Deup1 UTSW 9 15600968 missense possibly damaging 0.87
R4968:Deup1 UTSW 9 15592428 missense probably damaging 0.99
R4973:Deup1 UTSW 9 15612014 nonsense probably null
R5195:Deup1 UTSW 9 15575191 missense possibly damaging 0.92
R5231:Deup1 UTSW 9 15575199 missense probably damaging 0.96
R5470:Deup1 UTSW 9 15582620 splice site probably null
R5931:Deup1 UTSW 9 15561322 missense possibly damaging 0.55
R6049:Deup1 UTSW 9 15561256 missense possibly damaging 0.75
R6373:Deup1 UTSW 9 15561342 missense probably damaging 0.99
R7948:Deup1 UTSW 9 15610648 missense possibly damaging 0.76
R8373:Deup1 UTSW 9 15592375 missense possibly damaging 0.80
R8725:Deup1 UTSW 9 15592425 missense probably damaging 1.00
Z1177:Deup1 UTSW 9 15600903 missense probably null 1.00
Z1177:Deup1 UTSW 9 15607832 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AAGGCAGTGCAGATGCTATC -3'
(R):5'- CACGACAAACATTTGCCCTTG -3'

Sequencing Primer
(F):5'- ACCCATGAGATAGTGAAAGTCTG -3'
(R):5'- TTGGCTCTGTGCAGCGC -3'
Posted On2018-06-06