Incidental Mutation 'R6525:Nacad'
ID521727
Institutional Source Beutler Lab
Gene Symbol Nacad
Ensembl Gene ENSMUSG00000041073
Gene NameNAC alpha domain containing
SynonymsmKIAA0363
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6525 (G1)
Quality Score158.009
Status Validated
Chromosome11
Chromosomal Location6597823-6606053 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6602255 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 312 (L312P)
Ref Sequence ENSEMBL: ENSMUSP00000049490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045713]
Predicted Effect probably damaging
Transcript: ENSMUST00000045713
AA Change: L312P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049490
Gene: ENSMUSG00000041073
AA Change: L312P

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 70 87 N/A INTRINSIC
low complexity region 228 235 N/A INTRINSIC
low complexity region 266 277 N/A INTRINSIC
low complexity region 294 306 N/A INTRINSIC
low complexity region 328 354 N/A INTRINSIC
low complexity region 391 422 N/A INTRINSIC
low complexity region 454 479 N/A INTRINSIC
internal_repeat_1 537 689 6.19e-8 PROSPERO
low complexity region 692 713 N/A INTRINSIC
internal_repeat_1 732 889 6.19e-8 PROSPERO
low complexity region 924 939 N/A INTRINSIC
low complexity region 1159 1170 N/A INTRINSIC
low complexity region 1308 1325 N/A INTRINSIC
Pfam:NAC 1357 1413 2.9e-24 PFAM
low complexity region 1449 1466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177050
Predicted Effect probably benign
Transcript: ENSMUST00000177391
Meta Mutation Damage Score 0.0950 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.0%
Validation Efficiency 96% (71/74)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,137,659 E1447G probably benign Het
Acss2 A G 2: 155,550,417 N261S probably benign Het
Adcy8 C A 15: 64,737,394 G859* probably null Het
Agbl3 A T 6: 34,803,594 K496* probably null Het
Antxrl A T 14: 34,060,406 D182V probably damaging Het
Arid5b A G 10: 68,097,666 L559P possibly damaging Het
Azi2 T A 9: 118,047,595 S60T probably damaging Het
Bahcc1 T C 11: 120,285,222 Y1931H probably damaging Het
Cnga1 T A 5: 72,618,231 E49V probably damaging Het
Col3a1 A G 1: 45,347,179 N160D possibly damaging Het
Crem C A 18: 3,268,070 R267L probably damaging Het
Ddx52 T C 11: 83,953,319 probably null Het
Ddx6 T C 9: 44,623,629 I127T probably damaging Het
Dopey2 T A 16: 93,809,416 Y2094N probably damaging Het
Dst C A 1: 34,163,135 N181K probably damaging Het
Dusp7 A G 9: 106,369,284 K163E possibly damaging Het
Dynlt1a T A 17: 6,311,739 T55S probably benign Het
Enpp2 T C 15: 54,870,211 N451S probably benign Het
Faap100 C A 11: 120,378,764 probably null Het
Fam208b G A 13: 3,576,540 Q455* probably null Het
Fam53a T C 5: 33,607,918 N148S probably damaging Het
Fat2 T C 11: 55,283,800 D2029G probably damaging Het
Flcn A T 11: 59,794,172 N484K possibly damaging Het
Gbp10 T A 5: 105,236,084 E17D probably benign Het
Gm14226 T C 2: 155,025,083 V320A possibly damaging Het
Gna13 T C 11: 109,395,939 I196T probably damaging Het
Gorasp1 G T 9: 119,927,995 P374T possibly damaging Het
Hc T C 2: 34,991,224 D1461G probably benign Het
Hmcn1 T C 1: 150,697,566 N2111D probably damaging Het
Hs3st3b1 G A 11: 63,921,598 S97L probably benign Het
Hsdl2 A G 4: 59,612,696 T296A probably damaging Het
Impg2 A G 16: 56,205,149 D48G probably damaging Het
Kbtbd12 A T 6: 88,614,080 N383K probably benign Het
Kcnj12 T G 11: 61,069,571 F232V probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Homo
Ldhb T C 6: 142,490,465 D326G probably benign Het
Lrrc49 A G 9: 60,598,149 L607S probably damaging Het
Ltn1 A G 16: 87,420,186 S388P probably damaging Het
Mansc4 A G 6: 147,075,147 S324P probably benign Het
Meltf G A 16: 31,888,899 W368* probably null Het
Ndc1 G T 4: 107,368,107 G7W probably benign Het
Nmral1 T A 16: 4,714,432 K172* probably null Het
Nol9 G T 4: 152,039,449 R32L probably damaging Het
Nsun5 A G 5: 135,375,058 Y296C probably damaging Het
Olfr1301 C T 2: 111,754,984 T245I probably benign Het
Oscp1 A G 4: 126,076,778 D120G possibly damaging Het
Parp14 C T 16: 35,860,441 C274Y probably benign Het
Pced1b T A 15: 97,384,798 H239Q possibly damaging Het
Pgap1 T C 1: 54,481,889 I865V probably benign Het
Ppp6r3 T A 19: 3,493,936 S360C probably damaging Het
Prb1 A G 6: 132,207,504 S389P unknown Het
Prr16 T G 18: 51,303,155 S235R probably benign Het
Rab11fip1 T C 8: 27,156,499 N183S probably benign Het
Rcn1 A G 2: 105,388,975 probably null Het
Rimkla C A 4: 119,468,091 A374S probably benign Het
Skint8 A T 4: 111,928,738 D127V probably damaging Het
Slc12a6 A G 2: 112,352,451 K724E probably damaging Het
Slc13a3 T C 2: 165,406,747 N537S unknown Het
Slc26a5 T C 5: 21,820,350 D457G possibly damaging Het
Slx4ip T C 2: 137,000,218 V21A possibly damaging Het
Stt3b A G 9: 115,258,558 Y291H probably damaging Het
Syn3 G A 10: 86,467,052 P80S probably damaging Het
Tiam1 A T 16: 89,858,597 probably null Het
Tjp1 T C 7: 65,343,651 D58G probably damaging Het
Tmprss15 T A 16: 79,003,378 I621F probably damaging Het
Tns1 C T 1: 73,953,470 S683N probably damaging Het
Ttn A G 2: 76,943,092 L2322P probably damaging Het
Ugdh G T 5: 65,417,059 H409N probably damaging Het
Vmn2r81 T A 10: 79,293,726 M817K probably benign Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Zbtb34 A G 2: 33,412,133 V132A probably damaging Het
Zfp119b A G 17: 55,939,992 C33R possibly damaging Het
Other mutations in Nacad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Nacad APN 11 6600921 missense probably benign 0.24
IGL00903:Nacad APN 11 6600632 missense probably damaging 0.99
IGL01303:Nacad APN 11 6598279 missense possibly damaging 0.81
IGL01353:Nacad APN 11 6600530 missense possibly damaging 0.70
IGL01833:Nacad APN 11 6605700 missense unknown
IGL02267:Nacad APN 11 6602649 missense probably benign 0.14
IGL02531:Nacad APN 11 6598580 missense possibly damaging 0.90
IGL02994:Nacad APN 11 6599528 missense possibly damaging 0.83
IGL03121:Nacad APN 11 6600933 missense probably damaging 0.98
IGL03161:Nacad APN 11 6600378 nonsense probably null
FR4340:Nacad UTSW 11 6599761 small insertion probably benign
FR4342:Nacad UTSW 11 6599762 small insertion probably benign
FR4548:Nacad UTSW 11 6599752 small insertion probably benign
FR4548:Nacad UTSW 11 6599760 small insertion probably benign
FR4589:Nacad UTSW 11 6599753 small insertion probably benign
FR4976:Nacad UTSW 11 6599749 small insertion probably benign
FR4976:Nacad UTSW 11 6599756 small insertion probably benign
FR4976:Nacad UTSW 11 6599763 small insertion probably benign
PIT4402001:Nacad UTSW 11 6598621 missense probably benign 0.19
R0330:Nacad UTSW 11 6600903 missense probably benign
R0331:Nacad UTSW 11 6599441 missense possibly damaging 0.84
R0409:Nacad UTSW 11 6599810 missense probably benign 0.00
R0612:Nacad UTSW 11 6601382 missense possibly damaging 0.90
R0644:Nacad UTSW 11 6599486 missense possibly damaging 0.69
R0829:Nacad UTSW 11 6601158 missense probably benign 0.18
R1483:Nacad UTSW 11 6602217 missense probably damaging 0.99
R1583:Nacad UTSW 11 6601185 missense probably benign 0.08
R1905:Nacad UTSW 11 6602540 missense probably benign 0.15
R1907:Nacad UTSW 11 6602540 missense probably benign 0.15
R2361:Nacad UTSW 11 6600821 missense probably benign
R2979:Nacad UTSW 11 6601424 missense probably benign 0.06
R4192:Nacad UTSW 11 6605534 missense probably benign 0.44
R4381:Nacad UTSW 11 6600204 missense probably benign 0.18
R4539:Nacad UTSW 11 6600677 missense possibly damaging 0.94
R4751:Nacad UTSW 11 6605726 missense unknown
R4944:Nacad UTSW 11 6598507 missense possibly damaging 0.95
R4962:Nacad UTSW 11 6599169 missense probably damaging 1.00
R5102:Nacad UTSW 11 6598528 missense probably damaging 1.00
R5189:Nacad UTSW 11 6601611 missense probably damaging 0.98
R5296:Nacad UTSW 11 6605745 missense unknown
R5566:Nacad UTSW 11 6602136 missense probably damaging 1.00
R5634:Nacad UTSW 11 6602387 missense possibly damaging 0.88
R5725:Nacad UTSW 11 6601643 missense probably benign 0.15
R5748:Nacad UTSW 11 6598370 nonsense probably null
R5864:Nacad UTSW 11 6600581 missense probably benign
R5882:Nacad UTSW 11 6598568 missense possibly damaging 0.95
R6089:Nacad UTSW 11 6601331 missense probably benign 0.03
R6117:Nacad UTSW 11 6599810 missense probably benign 0.00
R6161:Nacad UTSW 11 6600902 missense probably benign
R6351:Nacad UTSW 11 6599235 missense probably damaging 1.00
R6351:Nacad UTSW 11 6600165 nonsense probably null
R6366:Nacad UTSW 11 6601196 missense probably benign 0.30
R6811:Nacad UTSW 11 6599400 missense possibly damaging 0.66
R6931:Nacad UTSW 11 6601877 missense probably benign 0.14
R6966:Nacad UTSW 11 6602634 missense possibly damaging 0.93
R7228:Nacad UTSW 11 6598412 missense probably benign 0.19
R7248:Nacad UTSW 11 6598589 nonsense probably null
R7556:Nacad UTSW 11 6601272 missense possibly damaging 0.90
R7594:Nacad UTSW 11 6602457 missense probably damaging 0.99
R7813:Nacad UTSW 11 6599071 missense probably benign 0.38
R7841:Nacad UTSW 11 6601031 missense probably benign 0.00
R7924:Nacad UTSW 11 6601031 missense probably benign 0.00
T0975:Nacad UTSW 11 6599750 small insertion probably benign
T0975:Nacad UTSW 11 6601622 missense probably benign 0.03
T0975:Nacad UTSW 11 6601632 missense probably benign 0.17
X0011:Nacad UTSW 11 6601074 missense probably benign 0.00
Z1176:Nacad UTSW 11 6602297 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTGGAAGATGAGGCTACC -3'
(R):5'- ACCTCCAGAGCTGTGTTCTCAG -3'

Sequencing Primer
(F):5'- ATCATCGGGTCGTTGGCCAG -3'
(R):5'- GTGTTCTCAGGGCGATCCTC -3'
Posted On2018-06-06