Mutagenetix > Incidental Mutation

Incidental Mutation 'R6525:Agbl3'

521696

Institutional Source

Beutler Lab

Gene Symbol

Agbl3

Ensembl Gene

ENSMUSG00000038836

Gene Name

ATP/GTP binding protein-like 3

Synonyms

4930431N21Rik, 2900053G10Rik, 6530406M24Rik

MMRRC Submission

044651-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6525 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

34780432-34859459 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 34803594 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 496 (K496*)

Ref Sequence

ENSEMBL: ENSMUSP00000110669 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115016] [ENSMUST00000115017] [ENSMUST00000135304] [ENSMUST00000148834]

AlphaFold

Q8CDP0

Predicted Effect

probably null
Transcript: ENSMUST00000115016
AA Change: K501*

SMART Domains

Protein: ENSMUSP00000110668
Gene: ENSMUSG00000038836
AA Change: K501*

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	314	563	2.7e-19	PFAM
low complexity region	614	629	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000115017
AA Change: K496*

SMART Domains

Protein: ENSMUSP00000110669
Gene: ENSMUSG00000038836
AA Change: K496*

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	309	560	1e-33	PFAM
low complexity region	609	624	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000135304

SMART Domains

Protein: ENSMUSP00000118303
Gene: ENSMUSG00000038836

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143474

Predicted Effect

probably benign
Transcript: ENSMUST00000148834

SMART Domains

Protein: ENSMUSP00000116066
Gene: ENSMUSG00000038836

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155726

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155890

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202017

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.0%

Validation Efficiency

96% (71/74)

MGI Phenotype

PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	A	G	3: 122,137,659	E1447G	probably benign	Het
Acss2	A	G	2: 155,550,417	N261S	probably benign	Het
Adcy8	C	A	15: 64,737,394	G859*	probably null	Het
Antxrl	A	T	14: 34,060,406	D182V	probably damaging	Het
Arid5b	A	G	10: 68,097,666	L559P	possibly damaging	Het
Azi2	T	A	9: 118,047,595	S60T	probably damaging	Het
Bahcc1	T	C	11: 120,285,222	Y1931H	probably damaging	Het
Cnga1	T	A	5: 72,618,231	E49V	probably damaging	Het
Col3a1	A	G	1: 45,347,179	N160D	possibly damaging	Het
Crem	C	A	18: 3,268,070	R267L	probably damaging	Het
Ddx52	T	C	11: 83,953,319		probably null	Het
Ddx6	T	C	9: 44,623,629	I127T	probably damaging	Het
Dopey2	T	A	16: 93,809,416	Y2094N	probably damaging	Het
Dst	C	A	1: 34,163,135	N181K	probably damaging	Het
Dusp7	A	G	9: 106,369,284	K163E	possibly damaging	Het
Dynlt1a	T	A	17: 6,311,739	T55S	probably benign	Het
Enpp2	T	C	15: 54,870,211	N451S	probably benign	Het
Faap100	C	A	11: 120,378,764		probably null	Het
Fam208b	G	A	13: 3,576,540	Q455*	probably null	Het
Fam53a	T	C	5: 33,607,918	N148S	probably damaging	Het
Fat2	T	C	11: 55,283,800	D2029G	probably damaging	Het
Flcn	A	T	11: 59,794,172	N484K	possibly damaging	Het
Gbp10	T	A	5: 105,236,084	E17D	probably benign	Het
Gm14226	T	C	2: 155,025,083	V320A	possibly damaging	Het
Gna13	T	C	11: 109,395,939	I196T	probably damaging	Het
Gorasp1	G	T	9: 119,927,995	P374T	possibly damaging	Het
Hc	T	C	2: 34,991,224	D1461G	probably benign	Het
Hmcn1	T	C	1: 150,697,566	N2111D	probably damaging	Het
Hs3st3b1	G	A	11: 63,921,598	S97L	probably benign	Het
Hsdl2	A	G	4: 59,612,696	T296A	probably damaging	Het
Impg2	A	G	16: 56,205,149	D48G	probably damaging	Het
Kbtbd12	A	T	6: 88,614,080	N383K	probably benign	Het
Kcnj12	T	G	11: 61,069,571	F232V	probably damaging	Het
Krt1	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	15: 101,850,378		probably benign	Homo
Ldhb	T	C	6: 142,490,465	D326G	probably benign	Het
Lrrc49	A	G	9: 60,598,149	L607S	probably damaging	Het
Ltn1	A	G	16: 87,420,186	S388P	probably damaging	Het
Mansc4	A	G	6: 147,075,147	S324P	probably benign	Het
Meltf	G	A	16: 31,888,899	W368*	probably null	Het
Nacad	A	G	11: 6,602,255	L312P	probably damaging	Het
Ndc1	G	T	4: 107,368,107	G7W	probably benign	Het
Nmral1	T	A	16: 4,714,432	K172*	probably null	Het
Nol9	G	T	4: 152,039,449	R32L	probably damaging	Het
Nsun5	A	G	5: 135,375,058	Y296C	probably damaging	Het
Olfr1301	C	T	2: 111,754,984	T245I	probably benign	Het
Oscp1	A	G	4: 126,076,778	D120G	possibly damaging	Het
Parp14	C	T	16: 35,860,441	C274Y	probably benign	Het
Pced1b	T	A	15: 97,384,798	H239Q	possibly damaging	Het
Pgap1	T	C	1: 54,481,889	I865V	probably benign	Het
Ppp6r3	T	A	19: 3,493,936	S360C	probably damaging	Het
Prb1	A	G	6: 132,207,504	S389P	unknown	Het
Prr16	T	G	18: 51,303,155	S235R	probably benign	Het
Rab11fip1	T	C	8: 27,156,499	N183S	probably benign	Het
Rcn1	A	G	2: 105,388,975		probably null	Het
Rimkla	C	A	4: 119,468,091	A374S	probably benign	Het
Skint8	A	T	4: 111,928,738	D127V	probably damaging	Het
Slc12a6	A	G	2: 112,352,451	K724E	probably damaging	Het
Slc13a3	T	C	2: 165,406,747	N537S	unknown	Het
Slc26a5	T	C	5: 21,820,350	D457G	possibly damaging	Het
Slx4ip	T	C	2: 137,000,218	V21A	possibly damaging	Het
Stt3b	A	G	9: 115,258,558	Y291H	probably damaging	Het
Syn3	G	A	10: 86,467,052	P80S	probably damaging	Het
Tiam1	A	T	16: 89,858,597		probably null	Het
Tjp1	T	C	7: 65,343,651	D58G	probably damaging	Het
Tmprss15	T	A	16: 79,003,378	I621F	probably damaging	Het
Tns1	C	T	1: 73,953,470	S683N	probably damaging	Het
Ttn	A	G	2: 76,943,092	L2322P	probably damaging	Het
Ugdh	G	T	5: 65,417,059	H409N	probably damaging	Het
Vmn2r81	T	A	10: 79,293,726	M817K	probably benign	Het
Wwc1	C	T	11: 35,853,437	E853K	probably benign	Het
Zbtb34	A	G	2: 33,412,133	V132A	probably damaging	Het
Zfp119b	A	G	17: 55,939,992	C33R	possibly damaging	Het

Other mutations in Agbl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Agbl3	APN	6	34846836	missense	probably damaging	1.00
IGL00835:Agbl3	APN	6	34799732	missense	probably damaging	1.00
IGL00840:Agbl3	APN	6	34799159	missense	possibly damaging	0.95
IGL01090:Agbl3	APN	6	34799887	missense	probably benign	0.40
IGL01123:Agbl3	APN	6	34846976	nonsense	probably null
IGL01707:Agbl3	APN	6	34839454	missense	possibly damaging	0.78
IGL01728:Agbl3	APN	6	34782157	start codon destroyed	probably null
IGL02335:Agbl3	APN	6	34799750	missense	probably damaging	1.00
IGL02420:Agbl3	APN	6	34785307	missense	possibly damaging	0.47
IGL02551:Agbl3	APN	6	34823071	missense	possibly damaging	0.88
IGL02974:Agbl3	APN	6	34799822	missense	probably damaging	1.00
IGL03167:Agbl3	APN	6	34857659	missense	possibly damaging	0.92
IGL03182:Agbl3	APN	6	34803500	missense	probably damaging	1.00
R0044:Agbl3	UTSW	6	34799899	missense	probably damaging	1.00
R0499:Agbl3	UTSW	6	34839335	missense	probably benign
R0639:Agbl3	UTSW	6	34799705	missense	probably damaging	1.00
R0850:Agbl3	UTSW	6	34799204	missense	probably damaging	1.00
R1004:Agbl3	UTSW	6	34803451	missense	probably damaging	0.99
R1080:Agbl3	UTSW	6	34828235	missense	probably benign	0.14
R1589:Agbl3	UTSW	6	34857517	missense	possibly damaging	0.77
R2361:Agbl3	UTSW	6	34832505	missense	possibly damaging	0.87
R2495:Agbl3	UTSW	6	34846764	missense	probably damaging	1.00
R3236:Agbl3	UTSW	6	34823087	splice site	probably null
R3237:Agbl3	UTSW	6	34823087	splice site	probably null
R3420:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3421:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3422:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3810:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R3811:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R4059:Agbl3	UTSW	6	34846899	missense	probably damaging	1.00
R4499:Agbl3	UTSW	6	34857598	missense	probably benign	0.00
R4687:Agbl3	UTSW	6	34798326	missense	probably damaging	1.00
R4854:Agbl3	UTSW	6	34785284	missense	probably damaging	0.97
R5354:Agbl3	UTSW	6	34814752	missense	probably benign	0.03
R5386:Agbl3	UTSW	6	34799196	missense	probably damaging	1.00
R5897:Agbl3	UTSW	6	34803573	missense	probably benign	0.21
R6018:Agbl3	UTSW	6	34799255	missense	probably damaging	1.00
R6148:Agbl3	UTSW	6	34857753	missense	possibly damaging	0.87
R6305:Agbl3	UTSW	6	34782210	missense	unknown
R6546:Agbl3	UTSW	6	34799299	missense	probably damaging	1.00
R6743:Agbl3	UTSW	6	34846953	missense	probably benign	0.03
R6986:Agbl3	UTSW	6	34839452	missense	probably benign	0.42
R7023:Agbl3	UTSW	6	34814769	missense	probably benign	0.02
R7411:Agbl3	UTSW	6	34814819	missense	probably damaging	0.99
R7469:Agbl3	UTSW	6	34814414	missense	probably damaging	1.00
R7631:Agbl3	UTSW	6	34857671	missense	possibly damaging	0.95
R7658:Agbl3	UTSW	6	34832508	missense	probably benign	0.11
R7743:Agbl3	UTSW	6	34846830	missense	probably damaging	1.00
R7801:Agbl3	UTSW	6	34839365	missense	probably benign	0.00
R8033:Agbl3	UTSW	6	34839494	missense	possibly damaging	0.95
R8203:Agbl3	UTSW	6	34799479	missense	probably damaging	1.00
R8769:Agbl3	UTSW	6	34857614	missense	probably damaging	0.96
R9072:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9073:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9210:Agbl3	UTSW	6	34798242	missense	probably damaging	0.98
R9255:Agbl3	UTSW	6	34812905	missense	probably damaging	1.00
R9536:Agbl3	UTSW	6	34846926	missense	probably benign
R9560:Agbl3	UTSW	6	34846908	missense	possibly damaging	0.94
R9662:Agbl3	UTSW	6	34832533	nonsense	probably null
RF014:Agbl3	UTSW	6	34799358	missense	possibly damaging	0.53
Z1177:Agbl3	UTSW	6	34799408	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GAGAAATGCGTCCTTATGGAAAAC -3'
(R):5'- GCTGGTCTTAGAATGAGGGATC -3'

Sequencing Primer
(F):5'- CGTATCTATAGAAGAAAATTCAGGGG -3'
(R):5'- TGGCCATTTAACAGTTCCAAATAG -3'

Posted On

2018-06-06