Incidental Mutation 'R7594:Nacad'
ID587636
Institutional Source Beutler Lab
Gene Symbol Nacad
Ensembl Gene ENSMUSG00000041073
Gene NameNAC alpha domain containing
SynonymsmKIAA0363
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7594 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location6597823-6606053 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6602457 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 245 (S245P)
Ref Sequence ENSEMBL: ENSMUSP00000049490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045713]
Predicted Effect probably damaging
Transcript: ENSMUST00000045713
AA Change: S245P

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000049490
Gene: ENSMUSG00000041073
AA Change: S245P

DomainStartEndE-ValueType
low complexity region 2 28 N/A INTRINSIC
low complexity region 70 87 N/A INTRINSIC
low complexity region 228 235 N/A INTRINSIC
low complexity region 266 277 N/A INTRINSIC
low complexity region 294 306 N/A INTRINSIC
low complexity region 328 354 N/A INTRINSIC
low complexity region 391 422 N/A INTRINSIC
low complexity region 454 479 N/A INTRINSIC
internal_repeat_1 537 689 6.19e-8 PROSPERO
low complexity region 692 713 N/A INTRINSIC
internal_repeat_1 732 889 6.19e-8 PROSPERO
low complexity region 924 939 N/A INTRINSIC
low complexity region 1159 1170 N/A INTRINSIC
low complexity region 1308 1325 N/A INTRINSIC
Pfam:NAC 1357 1413 2.9e-24 PFAM
low complexity region 1449 1466 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177050
Predicted Effect probably benign
Transcript: ENSMUST00000177391
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (62/63)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik T C 7: 104,059,263 E113G probably damaging Het
9530053A07Rik T C 7: 28,131,460 C33R probably damaging Het
Acsm3 A G 7: 119,784,990 probably null Het
Acvr2a T A 2: 48,894,737 L345* probably null Het
App T C 16: 85,080,002 D167G unknown Het
Arhgef33 A G 17: 80,370,305 D427G probably damaging Het
Arid2 T C 15: 96,390,994 S1675P probably damaging Het
Atp8a1 T C 5: 67,651,592 Y985C Het
AW209491 A G 13: 14,637,246 D228G probably benign Het
Casc3 G A 11: 98,821,485 A117T probably benign Het
Cass4 C T 2: 172,429,648 P645S probably benign Het
Ccar2 A T 14: 70,141,794 Y553* probably null Het
Cox16 A T 12: 81,474,578 probably null Het
Cpeb3 A T 19: 37,174,151 V275E possibly damaging Het
Dido1 A G 2: 180,675,112 V634A probably benign Het
Dnajb1 G A 8: 83,609,844 S81N probably benign Het
Dst A G 1: 34,213,013 K2262E probably damaging Het
Eya3 T C 4: 132,694,825 V237A probably benign Het
Fbxo31 T A 8: 121,552,368 D460V probably damaging Het
Gabrg3 A T 7: 56,982,695 N168K possibly damaging Het
Ggh C G 4: 20,049,833 S88C probably damaging Het
Gm10134 T C 2: 28,506,360 M89T unknown Het
Gm13084 A T 4: 143,812,716 I69N probably damaging Het
Kif17 T C 4: 138,277,925 L267P probably damaging Het
Ksr2 C A 5: 117,555,066 T193N possibly damaging Het
Lmtk2 T C 5: 144,173,746 L428P probably damaging Het
Mdn1 G T 4: 32,696,359 L1247F probably benign Het
Med24 T C 11: 98,715,097 Y323C probably damaging Het
Mthfd2 A G 6: 83,306,683 V339A probably benign Het
Mtus2 G T 5: 148,077,406 R336S probably benign Het
Muc16 T C 9: 18,645,062 T3312A unknown Het
Nacc1 T C 8: 84,675,002 D394G probably damaging Het
Nfatc2 A G 2: 168,523,348 V582A probably damaging Het
Nid2 T A 14: 19,768,723 D428E probably benign Het
Olfr1122 A G 2: 87,388,269 H188R probably damaging Het
Olfr1253 T A 2: 89,752,562 T89S probably benign Het
Olfr684 A G 7: 105,157,673 L3S probably benign Het
Osbpl5 A T 7: 143,693,797 L768Q probably benign Het
Plch2 C T 4: 155,007,027 V210I probably damaging Het
Plekhh1 C T 12: 79,076,503 T1153I possibly damaging Het
Ppp1r14c T C 10: 3,366,670 S2P possibly damaging Het
Psmd5 G T 2: 34,860,729 H239Q probably benign Het
Ptcd2 C A 13: 99,320,282 A345S possibly damaging Het
Sap30l G A 11: 57,810,121 probably null Het
Sec14l2 A G 11: 4,111,213 Y83H probably damaging Het
Slc2a9 A G 5: 38,351,291 I470T probably benign Het
Sp110 G A 1: 85,579,092 R417C Het
Syne1 A G 10: 5,215,190 probably null Het
Tg T A 15: 66,729,583 D1766E probably benign Het
Tlr12 T C 4: 128,617,680 E259G probably benign Het
Tlr6 T C 5: 64,953,251 Y771C probably damaging Het
Tnrc6b T A 15: 80,880,307 V670E possibly damaging Het
Top2b A G 14: 16,428,587 T1522A probably benign Het
Tpcn1 A G 5: 120,556,530 M158T possibly damaging Het
Ttn T C 2: 76,726,842 I29940V probably benign Het
Ttn G A 2: 76,751,354 T23065I probably damaging Het
Umodl1 A G 17: 30,954,805 S20G probably benign Het
Uts2r G T 11: 121,161,365 V352F possibly damaging Het
Vmn1r67 T A 7: 10,447,415 M202K possibly damaging Het
Vmn2r107 T C 17: 20,360,373 V524A probably benign Het
Zc3h12d C A 10: 7,862,618 D229E probably damaging Het
Zfp541 A G 7: 16,076,386 D116G probably damaging Het
Zfp971 A G 2: 178,034,000 E464G possibly damaging Het
Other mutations in Nacad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Nacad APN 11 6600921 missense probably benign 0.24
IGL00903:Nacad APN 11 6600632 missense probably damaging 0.99
IGL01303:Nacad APN 11 6598279 missense possibly damaging 0.81
IGL01353:Nacad APN 11 6600530 missense possibly damaging 0.70
IGL01833:Nacad APN 11 6605700 missense unknown
IGL02267:Nacad APN 11 6602649 missense probably benign 0.14
IGL02531:Nacad APN 11 6598580 missense possibly damaging 0.90
IGL02994:Nacad APN 11 6599528 missense possibly damaging 0.83
IGL03121:Nacad APN 11 6600933 missense probably damaging 0.98
IGL03161:Nacad APN 11 6600378 nonsense probably null
FR4340:Nacad UTSW 11 6599761 small insertion probably benign
FR4342:Nacad UTSW 11 6599762 small insertion probably benign
FR4548:Nacad UTSW 11 6599752 small insertion probably benign
FR4548:Nacad UTSW 11 6599760 small insertion probably benign
FR4589:Nacad UTSW 11 6599753 small insertion probably benign
FR4976:Nacad UTSW 11 6599749 small insertion probably benign
FR4976:Nacad UTSW 11 6599756 small insertion probably benign
FR4976:Nacad UTSW 11 6599763 small insertion probably benign
PIT4402001:Nacad UTSW 11 6598621 missense probably benign 0.19
R0330:Nacad UTSW 11 6600903 missense probably benign
R0331:Nacad UTSW 11 6599441 missense possibly damaging 0.84
R0409:Nacad UTSW 11 6599810 missense probably benign 0.00
R0612:Nacad UTSW 11 6601382 missense possibly damaging 0.90
R0644:Nacad UTSW 11 6599486 missense possibly damaging 0.69
R0829:Nacad UTSW 11 6601158 missense probably benign 0.18
R1483:Nacad UTSW 11 6602217 missense probably damaging 0.99
R1583:Nacad UTSW 11 6601185 missense probably benign 0.08
R1905:Nacad UTSW 11 6602540 missense probably benign 0.15
R1907:Nacad UTSW 11 6602540 missense probably benign 0.15
R2361:Nacad UTSW 11 6600821 missense probably benign
R2979:Nacad UTSW 11 6601424 missense probably benign 0.06
R4192:Nacad UTSW 11 6605534 missense probably benign 0.44
R4381:Nacad UTSW 11 6600204 missense probably benign 0.18
R4539:Nacad UTSW 11 6600677 missense possibly damaging 0.94
R4751:Nacad UTSW 11 6605726 missense unknown
R4944:Nacad UTSW 11 6598507 missense possibly damaging 0.95
R4962:Nacad UTSW 11 6599169 missense probably damaging 1.00
R5102:Nacad UTSW 11 6598528 missense probably damaging 1.00
R5189:Nacad UTSW 11 6601611 missense probably damaging 0.98
R5296:Nacad UTSW 11 6605745 missense unknown
R5566:Nacad UTSW 11 6602136 missense probably damaging 1.00
R5634:Nacad UTSW 11 6602387 missense possibly damaging 0.88
R5725:Nacad UTSW 11 6601643 missense probably benign 0.15
R5748:Nacad UTSW 11 6598370 nonsense probably null
R5864:Nacad UTSW 11 6600581 missense probably benign
R5882:Nacad UTSW 11 6598568 missense possibly damaging 0.95
R6089:Nacad UTSW 11 6601331 missense probably benign 0.03
R6117:Nacad UTSW 11 6599810 missense probably benign 0.00
R6161:Nacad UTSW 11 6600902 missense probably benign
R6351:Nacad UTSW 11 6599235 missense probably damaging 1.00
R6351:Nacad UTSW 11 6600165 nonsense probably null
R6366:Nacad UTSW 11 6601196 missense probably benign 0.30
R6525:Nacad UTSW 11 6602255 missense probably damaging 1.00
R6811:Nacad UTSW 11 6599400 missense possibly damaging 0.66
R6931:Nacad UTSW 11 6601877 missense probably benign 0.14
R6966:Nacad UTSW 11 6602634 missense possibly damaging 0.93
R7228:Nacad UTSW 11 6598412 missense probably benign 0.19
R7248:Nacad UTSW 11 6598589 nonsense probably null
R7556:Nacad UTSW 11 6601272 missense possibly damaging 0.90
R7813:Nacad UTSW 11 6599071 missense probably benign 0.38
R7841:Nacad UTSW 11 6601031 missense probably benign 0.00
R7924:Nacad UTSW 11 6601031 missense probably benign 0.00
T0975:Nacad UTSW 11 6599750 small insertion probably benign
T0975:Nacad UTSW 11 6601622 missense probably benign 0.03
T0975:Nacad UTSW 11 6601632 missense probably benign 0.17
X0011:Nacad UTSW 11 6601074 missense probably benign 0.00
Z1176:Nacad UTSW 11 6602297 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGTCATCTGCCACTGACC -3'
(R):5'- TCACGTTCCTGTCCAGCAAG -3'

Sequencing Primer
(F):5'- ATCTGCCACTGACCCTGATGG -3'
(R):5'- TTCCTGTCCAGCAAGCCAGG -3'
Posted On2019-10-24