Incidental Mutation 'R6525:Tmprss15'
ID521765
Institutional Source Beutler Lab
Gene Symbol Tmprss15
Ensembl Gene ENSMUSG00000022857
Gene Nametransmembrane protease, serine 15
SynonymsA130097D21Rik, enterokinase, enteropeptidase, Prss7
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6525 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location78953008-79091097 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79003378 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 621 (I621F)
Ref Sequence ENSEMBL: ENSMUSP00000023566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023566] [ENSMUST00000060402]
Predicted Effect probably damaging
Transcript: ENSMUST00000023566
AA Change: I621F

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023566
Gene: ENSMUSG00000022857
AA Change: I621F

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
SEA 52 172 1.62e-22 SMART
LDLa 228 268 1.74e-4 SMART
CUB 270 379 1.54e-11 SMART
MAM 387 549 7.33e-54 SMART
low complexity region 551 567 N/A INTRINSIC
CUB 569 679 1.72e-32 SMART
LDLa 687 724 7.32e-12 SMART
SR 723 813 3.12e-5 SMART
Tryp_SPc 829 1064 1.48e-95 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000060402
AA Change: I606F

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000052034
Gene: ENSMUSG00000022857
AA Change: I606F

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
SEA 52 172 1.62e-22 SMART
LDLa 213 253 1.74e-4 SMART
CUB 255 364 1.54e-11 SMART
MAM 372 534 7.33e-54 SMART
low complexity region 536 552 N/A INTRINSIC
CUB 554 664 1.72e-32 SMART
LDLa 672 709 7.32e-12 SMART
SR 708 798 3.12e-5 SMART
Tryp_SPc 814 1049 1.48e-95 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.0%
Validation Efficiency 96% (71/74)
MGI Phenotype FUNCTION: This gene encodes an enzyme that proteolytically activates the pancreatic proenzyme trypsinogen, converting it into trypsin. The encoded protein is cleaved into two chains that form a heterodimer linked by a disulfide bond. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,137,659 E1447G probably benign Het
Acss2 A G 2: 155,550,417 N261S probably benign Het
Adcy8 C A 15: 64,737,394 G859* probably null Het
Agbl3 A T 6: 34,803,594 K496* probably null Het
Antxrl A T 14: 34,060,406 D182V probably damaging Het
Arid5b A G 10: 68,097,666 L559P possibly damaging Het
Azi2 T A 9: 118,047,595 S60T probably damaging Het
Bahcc1 T C 11: 120,285,222 Y1931H probably damaging Het
Cnga1 T A 5: 72,618,231 E49V probably damaging Het
Col3a1 A G 1: 45,347,179 N160D possibly damaging Het
Crem C A 18: 3,268,070 R267L probably damaging Het
Ddx52 T C 11: 83,953,319 probably null Het
Ddx6 T C 9: 44,623,629 I127T probably damaging Het
Dopey2 T A 16: 93,809,416 Y2094N probably damaging Het
Dst C A 1: 34,163,135 N181K probably damaging Het
Dusp7 A G 9: 106,369,284 K163E possibly damaging Het
Dynlt1a T A 17: 6,311,739 T55S probably benign Het
Enpp2 T C 15: 54,870,211 N451S probably benign Het
Faap100 C A 11: 120,378,764 probably null Het
Fam208b G A 13: 3,576,540 Q455* probably null Het
Fam53a T C 5: 33,607,918 N148S probably damaging Het
Fat2 T C 11: 55,283,800 D2029G probably damaging Het
Flcn A T 11: 59,794,172 N484K possibly damaging Het
Gbp10 T A 5: 105,236,084 E17D probably benign Het
Gm14226 T C 2: 155,025,083 V320A possibly damaging Het
Gna13 T C 11: 109,395,939 I196T probably damaging Het
Gorasp1 G T 9: 119,927,995 P374T possibly damaging Het
Hc T C 2: 34,991,224 D1461G probably benign Het
Hmcn1 T C 1: 150,697,566 N2111D probably damaging Het
Hs3st3b1 G A 11: 63,921,598 S97L probably benign Het
Hsdl2 A G 4: 59,612,696 T296A probably damaging Het
Impg2 A G 16: 56,205,149 D48G probably damaging Het
Kbtbd12 A T 6: 88,614,080 N383K probably benign Het
Kcnj12 T G 11: 61,069,571 F232V probably damaging Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Homo
Ldhb T C 6: 142,490,465 D326G probably benign Het
Lrrc49 A G 9: 60,598,149 L607S probably damaging Het
Ltn1 A G 16: 87,420,186 S388P probably damaging Het
Mansc4 A G 6: 147,075,147 S324P probably benign Het
Meltf G A 16: 31,888,899 W368* probably null Het
Nacad A G 11: 6,602,255 L312P probably damaging Het
Ndc1 G T 4: 107,368,107 G7W probably benign Het
Nmral1 T A 16: 4,714,432 K172* probably null Het
Nol9 G T 4: 152,039,449 R32L probably damaging Het
Nsun5 A G 5: 135,375,058 Y296C probably damaging Het
Olfr1301 C T 2: 111,754,984 T245I probably benign Het
Oscp1 A G 4: 126,076,778 D120G possibly damaging Het
Parp14 C T 16: 35,860,441 C274Y probably benign Het
Pced1b T A 15: 97,384,798 H239Q possibly damaging Het
Pgap1 T C 1: 54,481,889 I865V probably benign Het
Ppp6r3 T A 19: 3,493,936 S360C probably damaging Het
Prb1 A G 6: 132,207,504 S389P unknown Het
Prr16 T G 18: 51,303,155 S235R probably benign Het
Rab11fip1 T C 8: 27,156,499 N183S probably benign Het
Rcn1 A G 2: 105,388,975 probably null Het
Rimkla C A 4: 119,468,091 A374S probably benign Het
Skint8 A T 4: 111,928,738 D127V probably damaging Het
Slc12a6 A G 2: 112,352,451 K724E probably damaging Het
Slc13a3 T C 2: 165,406,747 N537S unknown Het
Slc26a5 T C 5: 21,820,350 D457G possibly damaging Het
Slx4ip T C 2: 137,000,218 V21A possibly damaging Het
Stt3b A G 9: 115,258,558 Y291H probably damaging Het
Syn3 G A 10: 86,467,052 P80S probably damaging Het
Tiam1 A T 16: 89,858,597 probably null Het
Tjp1 T C 7: 65,343,651 D58G probably damaging Het
Tns1 C T 1: 73,953,470 S683N probably damaging Het
Ttn A G 2: 76,943,092 L2322P probably damaging Het
Ugdh G T 5: 65,417,059 H409N probably damaging Het
Vmn2r81 T A 10: 79,293,726 M817K probably benign Het
Wwc1 C T 11: 35,853,437 E853K probably benign Het
Zbtb34 A G 2: 33,412,133 V132A probably damaging Het
Zfp119b A G 17: 55,939,992 C33R possibly damaging Het
Other mutations in Tmprss15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Tmprss15 APN 16 78985994 missense possibly damaging 0.87
IGL00477:Tmprss15 APN 16 79021413 missense probably damaging 1.00
IGL01583:Tmprss15 APN 16 79071261 missense probably benign
IGL01896:Tmprss15 APN 16 79090790 missense probably benign 0.22
IGL02052:Tmprss15 APN 16 79087506 missense probably damaging 1.00
IGL02374:Tmprss15 APN 16 79035168 missense probably benign 0.00
IGL02505:Tmprss15 APN 16 78987741 missense probably benign 0.00
IGL02632:Tmprss15 APN 16 78985902 missense probably damaging 0.98
IGL02674:Tmprss15 APN 16 79001794 missense possibly damaging 0.72
PIT1430001:Tmprss15 UTSW 16 79024752 critical splice donor site probably null
R0106:Tmprss15 UTSW 16 79003389 missense probably damaging 0.99
R0106:Tmprss15 UTSW 16 79003389 missense probably damaging 0.99
R0195:Tmprss15 UTSW 16 79034334 missense probably benign 0.05
R0335:Tmprss15 UTSW 16 79024742 splice site probably benign
R0514:Tmprss15 UTSW 16 78968267 missense probably benign 0.05
R0552:Tmprss15 UTSW 16 79024749 splice site probably null
R0675:Tmprss15 UTSW 16 78985950 missense probably damaging 0.98
R0739:Tmprss15 UTSW 16 79024848 missense possibly damaging 0.62
R1435:Tmprss15 UTSW 16 79021454 missense probably benign 0.03
R1446:Tmprss15 UTSW 16 79078958 missense probably benign 0.01
R1572:Tmprss15 UTSW 16 79090829 missense probably benign 0.00
R1708:Tmprss15 UTSW 16 79054070 missense possibly damaging 0.95
R1893:Tmprss15 UTSW 16 79071418 missense probably benign
R2403:Tmprss15 UTSW 16 79057690 missense probably damaging 1.00
R2866:Tmprss15 UTSW 16 79035233 missense possibly damaging 0.65
R2913:Tmprss15 UTSW 16 78962190 missense probably benign 0.45
R2914:Tmprss15 UTSW 16 78962190 missense probably benign 0.45
R3425:Tmprss15 UTSW 16 79003433 missense possibly damaging 0.83
R3703:Tmprss15 UTSW 16 79054142 critical splice acceptor site probably null
R3916:Tmprss15 UTSW 16 78985996 missense probably damaging 1.00
R3950:Tmprss15 UTSW 16 79073186 missense probably benign 0.04
R4332:Tmprss15 UTSW 16 79034334 missense probably benign 0.15
R4392:Tmprss15 UTSW 16 79024438 missense probably damaging 1.00
R4515:Tmprss15 UTSW 16 78957356 missense probably benign 0.00
R4619:Tmprss15 UTSW 16 79021470 missense probably damaging 1.00
R4620:Tmprss15 UTSW 16 79021470 missense probably damaging 1.00
R4754:Tmprss15 UTSW 16 79054124 missense probably damaging 0.98
R4853:Tmprss15 UTSW 16 78960591 missense probably benign
R5159:Tmprss15 UTSW 16 79003410 missense probably benign 0.26
R5441:Tmprss15 UTSW 16 79071447 critical splice acceptor site probably null
R5824:Tmprss15 UTSW 16 79034313 missense probably damaging 0.99
R5970:Tmprss15 UTSW 16 79057659 missense probably benign 0.00
R6224:Tmprss15 UTSW 16 79024378 missense probably benign 0.08
R6257:Tmprss15 UTSW 16 78972225 missense probably damaging 1.00
R6313:Tmprss15 UTSW 16 78962170 missense probably benign 0.16
R6368:Tmprss15 UTSW 16 79006057 intron probably null
R6587:Tmprss15 UTSW 16 79071429 missense probably benign
R6894:Tmprss15 UTSW 16 79075814 nonsense probably null
R7018:Tmprss15 UTSW 16 79024853 missense possibly damaging 0.78
R7180:Tmprss15 UTSW 16 78967998 missense probably damaging 0.97
R7324:Tmprss15 UTSW 16 78962019 missense probably damaging 1.00
R7337:Tmprss15 UTSW 16 79071276 missense probably benign 0.01
R7558:Tmprss15 UTSW 16 79003414 missense possibly damaging 0.55
R7732:Tmprss15 UTSW 16 79003420 missense probably benign 0.11
R7792:Tmprss15 UTSW 16 79003387 missense probably damaging 1.00
R7829:Tmprss15 UTSW 16 78987650 missense probably benign 0.02
R7998:Tmprss15 UTSW 16 79001843 missense possibly damaging 0.79
R8009:Tmprss15 UTSW 16 79090863 missense probably damaging 0.96
R8145:Tmprss15 UTSW 16 78960585 missense probably damaging 1.00
R8183:Tmprss15 UTSW 16 79087512 missense probably benign 0.04
R8221:Tmprss15 UTSW 16 79024335 missense probably damaging 0.99
R8294:Tmprss15 UTSW 16 79071288 missense probably benign
RF005:Tmprss15 UTSW 16 78953801 makesense probably null
Predicted Primers PCR Primer
(F):5'- TTGGCAGAAGGGAAATCATTACC -3'
(R):5'- TTGCACTGTGGAAAGATCATCCC -3'

Sequencing Primer
(F):5'- AATCTGTAACATGTTACCTTGCTG -3'
(R):5'- TGTGGAAAGATCATCCCAGTCAC -3'
Posted On2018-06-06