Incidental Mutation 'R6508:Vmn2r80'
ID524009
Institutional Source Beutler Lab
Gene Symbol Vmn2r80
Ensembl Gene ENSMUSG00000091888
Gene Namevomeronasal 2, receptor 80
SynonymsEG624765
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R6508 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location79148797-79195012 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79194456 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 705 (F705L)
Ref Sequence ENSEMBL: ENSMUSP00000132299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165834]
Predicted Effect probably benign
Transcript: ENSMUST00000165834
AA Change: F705L

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000132299
Gene: ENSMUSG00000091888
AA Change: F705L

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:ANF_receptor 79 474 1.5e-36 PFAM
Pfam:NCD3G 517 570 7.9e-22 PFAM
Pfam:7tm_3 603 838 6.2e-49 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brca2 A T 5: 150,536,593 E444D possibly damaging Het
C87977 A T 4: 144,207,601 L312* probably null Het
Camkk2 G T 5: 122,746,319 N346K probably damaging Het
Car4 C A 11: 84,965,643 D252E possibly damaging Het
Chd1 A G 17: 15,738,633 K649R probably benign Het
Col12a1 A G 9: 79,649,949 Y1966H probably damaging Het
Cts6 T A 13: 61,196,407 H277L probably damaging Het
Dcc G T 18: 71,306,073 P1246Q probably damaging Het
Dlg5 G A 14: 24,138,706 T1739I probably benign Het
Eci1 T A 17: 24,437,309 N164K probably damaging Het
Entpd7 G A 19: 43,691,086 R26H probably damaging Het
Fanci A G 7: 79,443,768 K1008E probably damaging Het
Gm13124 G A 4: 144,565,020 R39* probably null Het
Htr2b T C 1: 86,102,464 T170A possibly damaging Het
Irgm2 A G 11: 58,219,501 E18G probably benign Het
Ispd C T 12: 36,426,299 A180V possibly damaging Het
Kdm1a A T 4: 136,554,310 V630E probably damaging Het
Keap1 G A 9: 21,231,714 T501I possibly damaging Het
L3mbtl3 T A 10: 26,318,427 H424L unknown Het
Lrrc14b C T 13: 74,363,218 D248N possibly damaging Het
Macf1 T A 4: 123,469,742 D3364V probably damaging Het
Map3k20 G A 2: 72,441,909 G794S probably benign Het
Mcat T C 15: 83,549,251 Q34R probably benign Het
Mettl4 T C 17: 94,743,945 E148G probably damaging Het
Mgat3 T C 15: 80,212,024 S351P possibly damaging Het
Mllt1 A T 17: 56,927,054 I44N probably damaging Het
Mlxipl G T 5: 135,128,620 A337S probably benign Het
Naip1 A G 13: 100,436,465 F254L probably damaging Het
Obscn A T 11: 59,054,147 probably null Het
Olfr1494 C T 19: 13,749,354 P83S probably damaging Het
Pcdh12 G A 18: 38,281,337 R912* probably null Het
Pcdh17 A G 14: 84,447,979 N629D probably damaging Het
Pcnx T C 12: 81,912,705 I170T probably damaging Het
Pgr A G 9: 8,956,289 Y746C probably damaging Het
Pum2 T C 12: 8,748,861 Y991H probably benign Het
Rcc1l A T 5: 134,169,238 V185D probably damaging Het
Scarb1 A T 5: 125,304,325 S52T possibly damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Spata4 T C 8: 54,600,852 S18P probably benign Het
Stard13 G A 5: 151,063,289 T134I probably benign Het
Tbc1d32 C T 10: 56,224,690 C64Y probably damaging Het
Tll1 T G 8: 64,098,460 I296L probably damaging Het
Tmem229b T G 12: 78,964,906 T84P probably damaging Het
Ttn T C 2: 76,714,413 T32782A possibly damaging Het
Vmn1r73 G A 7: 11,756,704 V150I possibly damaging Het
Other mutations in Vmn2r80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01084:Vmn2r80 APN 10 79194599 missense probably damaging 1.00
IGL01325:Vmn2r80 APN 10 79194247 missense possibly damaging 0.62
IGL01611:Vmn2r80 APN 10 79171654 missense probably damaging 1.00
IGL01799:Vmn2r80 APN 10 79171551 missense possibly damaging 0.95
IGL01877:Vmn2r80 APN 10 79171500 splice site probably null
IGL02673:Vmn2r80 APN 10 79169484 missense probably benign 0.02
IGL02756:Vmn2r80 APN 10 79194311 missense probably damaging 1.00
IGL02820:Vmn2r80 APN 10 79171605 missense probably benign 0.04
IGL03382:Vmn2r80 APN 10 79169528 missense probably damaging 1.00
R0071:Vmn2r80 UTSW 10 79171732 missense possibly damaging 0.83
R0071:Vmn2r80 UTSW 10 79171732 missense possibly damaging 0.83
R0129:Vmn2r80 UTSW 10 79169496 missense probably damaging 1.00
R0325:Vmn2r80 UTSW 10 79148939 missense possibly damaging 0.89
R0567:Vmn2r80 UTSW 10 79194831 missense possibly damaging 0.89
R1510:Vmn2r80 UTSW 10 79169719 missense possibly damaging 0.69
R1519:Vmn2r80 UTSW 10 79194219 missense probably damaging 1.00
R1520:Vmn2r80 UTSW 10 79194760 missense probably damaging 1.00
R1627:Vmn2r80 UTSW 10 79194415 missense probably damaging 1.00
R1709:Vmn2r80 UTSW 10 79194389 missense probably benign 0.04
R2116:Vmn2r80 UTSW 10 79194724 missense probably benign 0.09
R2237:Vmn2r80 UTSW 10 79168270 missense probably damaging 1.00
R2308:Vmn2r80 UTSW 10 79171621 missense probably damaging 1.00
R2893:Vmn2r80 UTSW 10 79148865 missense possibly damaging 0.63
R3408:Vmn2r80 UTSW 10 79168393 missense possibly damaging 0.95
R4502:Vmn2r80 UTSW 10 79148930 missense probably benign 0.00
R4685:Vmn2r80 UTSW 10 79194328 missense possibly damaging 0.95
R4851:Vmn2r80 UTSW 10 79194322 missense possibly damaging 0.68
R4947:Vmn2r80 UTSW 10 79194698 missense probably damaging 1.00
R5112:Vmn2r80 UTSW 10 79194458 missense possibly damaging 0.61
R5217:Vmn2r80 UTSW 10 79169146 missense possibly damaging 0.62
R5226:Vmn2r80 UTSW 10 79194040 missense probably benign 0.36
R5512:Vmn2r80 UTSW 10 79168232 missense probably benign 0.00
R5618:Vmn2r80 UTSW 10 79148921 missense probably benign
R5959:Vmn2r80 UTSW 10 79169479 missense probably benign 0.00
R6104:Vmn2r80 UTSW 10 79149020 missense probably benign 0.00
R6110:Vmn2r80 UTSW 10 79182003 missense probably damaging 1.00
R6270:Vmn2r80 UTSW 10 79194325 missense probably benign 0.00
R6843:Vmn2r80 UTSW 10 79169668 missense probably benign 0.08
R6894:Vmn2r80 UTSW 10 79169604 missense probably benign 0.06
R7048:Vmn2r80 UTSW 10 79194319 missense probably damaging 1.00
R7149:Vmn2r80 UTSW 10 79194820 missense probably benign 0.00
R7262:Vmn2r80 UTSW 10 79169745 missense probably damaging 0.98
R7559:Vmn2r80 UTSW 10 79194625 missense probably benign 0.00
R7622:Vmn2r80 UTSW 10 79194263 missense probably damaging 1.00
R8003:Vmn2r80 UTSW 10 79148877 missense probably benign 0.16
R8207:Vmn2r80 UTSW 10 79194316 nonsense probably null
Z1176:Vmn2r80 UTSW 10 79169477 missense not run
Z1176:Vmn2r80 UTSW 10 79194398 missense possibly damaging 0.65
Z1176:Vmn2r80 UTSW 10 79194607 missense probably damaging 1.00
Z1176:Vmn2r80 UTSW 10 79194771 missense probably damaging 1.00
Z1177:Vmn2r80 UTSW 10 79169477 missense not run
Predicted Primers PCR Primer
(F):5'- GGCCTTCCAAATACAGCAATGTG -3'
(R):5'- GCATGCTGAAAGCCAGTGAC -3'

Sequencing Primer
(F):5'- CAGCAATGTGTATAATGCAACAGTAC -3'
(R):5'- CATTAAATCTGTCGGGCAGTC -3'
Posted On2018-06-22