Incidental Mutation 'R6648:Ccar2'
ID524386
Institutional Source Beutler Lab
Gene Symbol Ccar2
Ensembl Gene ENSMUSG00000033712
Gene Namecell cycle activator and apoptosis regulator 2
Synonyms2610301G19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.514) question?
Stock #R6648 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location70138164-70153811 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 70139225 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 890 (D890A)
Ref Sequence ENSEMBL: ENSMUSP00000036924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022680] [ENSMUST00000035612]
Predicted Effect probably benign
Transcript: ENSMUST00000022680
SMART Domains Protein: ENSMUSP00000022680
Gene: ENSMUSG00000022089

DomainStartEndE-ValueType
BAR 5 225 2.05e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000035612
AA Change: D890A

PolyPhen 2 Score 0.290 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000036924
Gene: ENSMUSG00000033712
AA Change: D890A

DomainStartEndE-ValueType
low complexity region 23 37 N/A INTRINSIC
Pfam:S1-like 55 112 1.3e-29 PFAM
DBC1 339 462 8.48e-73 SMART
low complexity region 496 507 N/A INTRINSIC
low complexity region 534 545 N/A INTRINSIC
low complexity region 563 601 N/A INTRINSIC
low complexity region 627 640 N/A INTRINSIC
low complexity region 647 660 N/A INTRINSIC
SCOP:d2mysb_ 703 747 2e-3 SMART
Blast:HDc 704 758 7e-7 BLAST
coiled coil region 828 898 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227589
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228049
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 98% (42/43)
MGI Phenotype PHENOTYPE: Homozygous null mice on a high fat diet are resistant to hepatic steatosis and associated liver inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1500015O10Rik T A 1: 43,738,691 F87I probably damaging Het
Aars2 T C 17: 45,516,564 Y511H probably damaging Het
Arhgef38 A T 3: 133,132,475 I600N probably damaging Het
Cacna1g A T 11: 94,432,569 C1270S probably damaging Het
Cep76 A T 18: 67,619,734 V548D probably benign Het
Chat T G 14: 32,454,694 Q41P probably benign Het
Ddx24 T A 12: 103,408,375 N850I probably benign Het
Dst A G 1: 34,262,041 I5879V possibly damaging Het
Ece1 A G 4: 137,921,159 T92A probably benign Het
Fpgs G T 2: 32,684,787 C439* probably null Het
Gm21994 T C 2: 150,255,177 I111V probably benign Het
H2-Q4 A T 17: 35,383,005 E281V probably damaging Het
Hydin A G 8: 110,525,667 probably null Het
Iqgap2 T C 13: 95,682,211 E679G probably benign Het
Kif12 A T 4: 63,171,317 probably null Het
Kif21b T C 1: 136,152,397 V557A probably benign Het
Mki67 C G 7: 135,697,440 S1955T probably damaging Het
Mybpc1 G A 10: 88,522,999 T1110M probably damaging Het
Myh9 T C 15: 77,766,772 H1625R probably benign Het
Nbeal2 G A 9: 110,637,642 T704M probably damaging Het
Olfr1378 G A 11: 50,969,173 D52N probably damaging Het
Olfr1438-ps1 A T 19: 12,333,766 M30K probably benign Het
Osbpl9 C A 4: 109,091,679 Q91H possibly damaging Het
Pcsk5 A T 19: 17,575,821 L665Q probably damaging Het
Pgm5 T C 19: 24,861,632 D53G probably benign Het
Plcd4 A G 1: 74,552,013 D189G probably benign Het
Plxnb1 A T 9: 109,104,330 Q676L probably benign Het
Prss33 A G 17: 23,834,702 S134P probably benign Het
Rln1 G T 19: 29,332,121 T86K probably benign Het
Rnf213 G A 11: 119,479,920 A4785T possibly damaging Het
Rsf1 GGCG GGCGACGGCCGCG 7: 97,579,906 probably benign Het
Sh3tc2 T C 18: 62,015,040 C1274R probably benign Het
Slc35a5 A T 16: 45,143,917 F318I probably damaging Het
Slc41a3 T C 6: 90,619,508 F20L probably damaging Het
Socs4 T A 14: 47,290,176 N189K probably benign Het
Tiam2 A T 17: 3,506,873 E1196V probably damaging Het
Tmc3 T A 7: 83,597,543 V164D probably damaging Het
Trim46 T C 3: 89,235,242 E623G possibly damaging Het
Ubr4 C A 4: 139,452,719 C3403* probably null Het
Vmn1r194 A T 13: 22,244,524 T104S probably benign Het
Vmn2r112 A T 17: 22,618,486 I643F probably damaging Het
Zmynd11 T G 13: 9,713,021 S95R probably benign Het
Zswim4 C A 8: 84,230,914 R175L probably benign Het
Other mutations in Ccar2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Ccar2 APN 14 70142531 nonsense probably null
IGL01351:Ccar2 APN 14 70145862 missense probably benign 0.03
IGL01450:Ccar2 APN 14 70139751 splice site probably benign
IGL02306:Ccar2 APN 14 70142022 missense probably benign 0.01
IGL03403:Ccar2 APN 14 70140068 missense probably damaging 1.00
R0332:Ccar2 UTSW 14 70141935 splice site probably benign
R0502:Ccar2 UTSW 14 70140982 missense probably benign 0.00
R0827:Ccar2 UTSW 14 70139838 missense probably benign 0.00
R1022:Ccar2 UTSW 14 70140515 missense probably damaging 1.00
R1024:Ccar2 UTSW 14 70140515 missense probably damaging 1.00
R1160:Ccar2 UTSW 14 70139769 missense probably benign 0.42
R1258:Ccar2 UTSW 14 70152673 missense probably benign 0.24
R1389:Ccar2 UTSW 14 70140109 missense possibly damaging 0.46
R1532:Ccar2 UTSW 14 70142956 missense probably benign 0.01
R1870:Ccar2 UTSW 14 70140497 missense probably damaging 1.00
R2127:Ccar2 UTSW 14 70139651 missense probably benign 0.33
R4233:Ccar2 UTSW 14 70151091 missense possibly damaging 0.76
R4569:Ccar2 UTSW 14 70151910 splice site probably null
R4799:Ccar2 UTSW 14 70139554 missense probably damaging 0.99
R5026:Ccar2 UTSW 14 70142502 missense possibly damaging 0.89
R5435:Ccar2 UTSW 14 70139327 missense probably damaging 1.00
R5893:Ccar2 UTSW 14 70151351 missense probably benign 0.28
R6446:Ccar2 UTSW 14 70143069 missense probably benign 0.31
R6594:Ccar2 UTSW 14 70140476 missense probably damaging 1.00
R7103:Ccar2 UTSW 14 70141977 missense probably damaging 0.99
R7594:Ccar2 UTSW 14 70141794 nonsense probably null
R7679:Ccar2 UTSW 14 70139235 nonsense probably null
R7975:Ccar2 UTSW 14 70143469 missense possibly damaging 0.51
R8071:Ccar2 UTSW 14 70152453 missense probably benign 0.26
V5088:Ccar2 UTSW 14 70151289 missense probably damaging 0.99
V5622:Ccar2 UTSW 14 70151289 missense probably damaging 0.99
V5622:Ccar2 UTSW 14 70151289 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCTGAGTCTCCTAAGAACCC -3'
(R):5'- CAGTGGACTGATCAGAGCCTTC -3'

Sequencing Primer
(F):5'- GTCTCCTAAGAACCCAGTATATGGAG -3'
(R):5'- GATCAGAGCCTTCCTGCCATG -3'
Posted On2018-06-22