Incidental Mutation 'R6589:Cdh4'
ID 524494
Institutional Source Beutler Lab
Gene Symbol Cdh4
Ensembl Gene ENSMUSG00000000305
Gene Name cadherin 4
Synonyms R-Cadh, Rcad, R-cadherin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6589 (G1)
Quality Score 185.009
Status Validated
Chromosome 2
Chromosomal Location 179442431-179899373 bp(+) (GRCm38)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 179881996 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000000314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000314]
AlphaFold P39038
Predicted Effect probably null
Transcript: ENSMUST00000000314
SMART Domains Protein: ENSMUSP00000000314
Gene: ENSMUSG00000000305

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Cadherin_pro 30 121 1.18e-30 SMART
CA 187 272 2.31e-15 SMART
CA 296 387 4.33e-29 SMART
CA 410 503 2.21e-12 SMART
CA 526 610 7.16e-21 SMART
CA 630 715 3.78e-2 SMART
transmembrane domain 730 752 N/A INTRINSIC
Pfam:Cadherin_C 760 909 2.5e-52 PFAM
Meta Mutation Damage Score 0.9491 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.0%
Validation Efficiency 100% (26/26)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. The encoded protein is involved in retinal angiogenesis during development where it plays a crucial role in the endothelial-astrocyte interactions. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in dilation of the proximal renal tubules and extensive vacuolization of tubule epithelium. Uretic bud epithelium appear disorganized and exhibit increased apoptosis at E15.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 29 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd55 G A 13: 112,348,863 probably null Het
Asic2 G T 11: 80,886,604 A427D possibly damaging Het
B3gnt2 T A 11: 22,837,117 I24F probably damaging Het
BC030500 T C 8: 58,912,922 probably benign Het
Cramp1l T C 17: 24,977,492 probably null Het
Fam19a2 T A 10: 123,704,392 V51E probably damaging Het
Fam72a A T 1: 131,533,816 I80F probably damaging Het
Fbxo43 T C 15: 36,162,540 T174A probably damaging Het
Fgf11 C A 11: 69,799,435 V109L probably damaging Het
Fggy A G 4: 95,597,638 I74V probably benign Het
Fshr T C 17: 88,988,607 D224G probably damaging Het
Gm5415 A T 1: 32,546,711 D39E probably benign Het
Gm6465 A G 5: 11,848,161 T81A possibly damaging Het
Gm9268 T A 7: 43,023,598 S142T possibly damaging Het
Hdac9 T C 12: 34,215,029 E908G probably damaging Het
Hspa4l T G 3: 40,757,055 L121V probably damaging Het
Klk1b16 A G 7: 44,141,470 D232G probably benign Het
Lpl G T 8: 68,896,807 M328I probably benign Het
Mgat4a T C 1: 37,444,895 E498G probably damaging Het
Mup11 T A 4: 60,659,541 Q91L possibly damaging Het
Myoc T A 1: 162,648,619 Y297* probably null Het
Olfr126 T A 17: 37,850,836 Y81* probably null Het
Siva1 A G 12: 112,646,838 E40G probably damaging Het
Smarca2 T A 19: 26,619,884 H55Q possibly damaging Het
Taf1b A G 12: 24,556,528 E449G possibly damaging Het
Tcaf3 A T 6: 42,594,061 N252K possibly damaging Het
Trim3 A G 7: 105,617,960 L404P probably damaging Het
Vmn2r114 T C 17: 23,291,668 T613A probably damaging Het
Zfp358 T A 8: 3,495,907 F163Y probably damaging Het
Other mutations in Cdh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Cdh4 APN 2 179874144 missense probably damaging 1.00
IGL01411:Cdh4 APN 2 179780403 missense probably damaging 0.96
IGL01752:Cdh4 APN 2 179890884 missense probably damaging 1.00
IGL02814:Cdh4 APN 2 179780474 missense probably benign 0.01
R0082:Cdh4 UTSW 2 179894188 missense possibly damaging 0.75
R0357:Cdh4 UTSW 2 179847340 missense probably damaging 1.00
R1521:Cdh4 UTSW 2 179797558 missense probably damaging 1.00
R1591:Cdh4 UTSW 2 179886864 critical splice donor site probably null
R1622:Cdh4 UTSW 2 179889092 missense possibly damaging 0.56
R1762:Cdh4 UTSW 2 179797480 missense probably benign 0.01
R1794:Cdh4 UTSW 2 179886842 missense probably damaging 1.00
R2275:Cdh4 UTSW 2 179890847 missense probably damaging 1.00
R2277:Cdh4 UTSW 2 179797524 missense possibly damaging 0.88
R3686:Cdh4 UTSW 2 179780367 missense probably benign 0.09
R3861:Cdh4 UTSW 2 179874097 missense probably damaging 1.00
R4078:Cdh4 UTSW 2 179889173 missense possibly damaging 0.93
R4495:Cdh4 UTSW 2 179780389 missense probably damaging 0.98
R4715:Cdh4 UTSW 2 179780467 missense probably benign 0.03
R4893:Cdh4 UTSW 2 179847419 intron probably benign
R5029:Cdh4 UTSW 2 179881949 missense possibly damaging 0.93
R5363:Cdh4 UTSW 2 179886763 missense probably benign
R5542:Cdh4 UTSW 2 179860226 missense probably damaging 0.98
R5773:Cdh4 UTSW 2 179885996 missense probably damaging 1.00
R5791:Cdh4 UTSW 2 179895767 missense probably damaging 1.00
R6262:Cdh4 UTSW 2 179797626 missense probably damaging 1.00
R6338:Cdh4 UTSW 2 179890812 missense probably damaging 1.00
R6607:Cdh4 UTSW 2 179874096 missense probably benign 0.00
R6653:Cdh4 UTSW 2 179780428 missense probably benign 0.34
R6711:Cdh4 UTSW 2 179890931 missense probably damaging 1.00
R6744:Cdh4 UTSW 2 179847387 missense possibly damaging 0.68
R6824:Cdh4 UTSW 2 179797558 missense probably damaging 1.00
R6901:Cdh4 UTSW 2 179860194 missense probably benign 0.19
R6981:Cdh4 UTSW 2 179797504 missense probably benign 0.28
R7285:Cdh4 UTSW 2 179797465 missense probably benign 0.00
R7514:Cdh4 UTSW 2 179890843 missense possibly damaging 0.91
R7541:Cdh4 UTSW 2 179444810 splice site probably null
R7560:Cdh4 UTSW 2 179890902 missense probably benign 0.25
R8146:Cdh4 UTSW 2 179874078 missense possibly damaging 0.91
R8833:Cdh4 UTSW 2 179894035 missense possibly damaging 0.61
R9075:Cdh4 UTSW 2 179860147 missense probably damaging 0.97
R9203:Cdh4 UTSW 2 179780403 missense probably damaging 0.96
Z1177:Cdh4 UTSW 2 179780326 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- TTCCTGAGAACCGTATAGAGACAG -3'
(R):5'- CCAGCATGGATATGAAGGCC -3'

Sequencing Primer
(F):5'- GTAGTAGCCAACCTCACGGTGATG -3'
(R):5'- TGGATATGAAGGCCAGAATCTTCCC -3'
Posted On 2018-06-22