Mutagenetix > Incidental Mutation

Incidental Mutation 'R6589:Cdh4'

524494

Institutional Source

Beutler Lab

Gene Symbol

Cdh4

Ensembl Gene

ENSMUSG00000000305

Gene Name

cadherin 4

Synonyms

R-Cadh, Rcad, R-cadherin

MMRRC Submission

044713-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6589 (G1)

Quality Score

185.009

Status

Validated

Chromosome

Chromosomal Location

179442431-179899373 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

G to A at 179881996 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000000314 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000314]

AlphaFold

P39038

Predicted Effect

probably null
Transcript: ENSMUST00000000314

SMART Domains

Protein: ENSMUSP00000000314
Gene: ENSMUSG00000000305

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Cadherin_pro	30	121	1.18e-30	SMART
CA	187	272	2.31e-15	SMART
CA	296	387	4.33e-29	SMART
CA	410	503	2.21e-12	SMART
CA	526	610	7.16e-21	SMART
CA	630	715	3.78e-2	SMART
transmembrane domain	730	752	N/A	INTRINSIC
Pfam:Cadherin_C	760	909	2.5e-52	PFAM

Meta Mutation Damage Score

0.9491

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.0%

Validation Efficiency

100% (26/26)

MGI Phenotype

FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. The encoded protein is involved in retinal angiogenesis during development where it plays a crucial role in the endothelial-astrocyte interactions. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutation of this gene results in dilation of the proximal renal tubules and extensive vacuolization of tubule epithelium. Uretic bud epithelium appear disorganized and exhibit increased apoptosis at E15.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 29 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankrd55	G	A	13: 112,348,863		probably null	Het
Asic2	G	T	11: 80,886,604	A427D	possibly damaging	Het
B3gnt2	T	A	11: 22,837,117	I24F	probably damaging	Het
BC030500	T	C	8: 58,912,922		probably benign	Het
Cramp1l	T	C	17: 24,977,492		probably null	Het
Fam19a2	T	A	10: 123,704,392	V51E	probably damaging	Het
Fam72a	A	T	1: 131,533,816	I80F	probably damaging	Het
Fbxo43	T	C	15: 36,162,540	T174A	probably damaging	Het
Fgf11	C	A	11: 69,799,435	V109L	probably damaging	Het
Fggy	A	G	4: 95,597,638	I74V	probably benign	Het
Fshr	T	C	17: 88,988,607	D224G	probably damaging	Het
Gm5415	A	T	1: 32,546,711	D39E	probably benign	Het
Gm6465	A	G	5: 11,848,161	T81A	possibly damaging	Het
Gm9268	T	A	7: 43,023,598	S142T	possibly damaging	Het
Hdac9	T	C	12: 34,215,029	E908G	probably damaging	Het
Hspa4l	T	G	3: 40,757,055	L121V	probably damaging	Het
Klk1b16	A	G	7: 44,141,470	D232G	probably benign	Het
Lpl	G	T	8: 68,896,807	M328I	probably benign	Het
Mgat4a	T	C	1: 37,444,895	E498G	probably damaging	Het
Mup11	T	A	4: 60,659,541	Q91L	possibly damaging	Het
Myoc	T	A	1: 162,648,619	Y297*	probably null	Het
Olfr126	T	A	17: 37,850,836	Y81*	probably null	Het
Siva1	A	G	12: 112,646,838	E40G	probably damaging	Het
Smarca2	T	A	19: 26,619,884	H55Q	possibly damaging	Het
Taf1b	A	G	12: 24,556,528	E449G	possibly damaging	Het
Tcaf3	A	T	6: 42,594,061	N252K	possibly damaging	Het
Trim3	A	G	7: 105,617,960	L404P	probably damaging	Het
Vmn2r114	T	C	17: 23,291,668	T613A	probably damaging	Het
Zfp358	T	A	8: 3,495,907	F163Y	probably damaging	Het

Other mutations in Cdh4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01149:Cdh4	APN	2	179874144	missense	probably damaging	1.00
IGL01411:Cdh4	APN	2	179780403	missense	probably damaging	0.96
IGL01752:Cdh4	APN	2	179890884	missense	probably damaging	1.00
IGL02814:Cdh4	APN	2	179780474	missense	probably benign	0.01
R0082:Cdh4	UTSW	2	179894188	missense	possibly damaging	0.75
R0357:Cdh4	UTSW	2	179847340	missense	probably damaging	1.00
R1521:Cdh4	UTSW	2	179797558	missense	probably damaging	1.00
R1591:Cdh4	UTSW	2	179886864	critical splice donor site	probably null
R1622:Cdh4	UTSW	2	179889092	missense	possibly damaging	0.56
R1762:Cdh4	UTSW	2	179797480	missense	probably benign	0.01
R1794:Cdh4	UTSW	2	179886842	missense	probably damaging	1.00
R2275:Cdh4	UTSW	2	179890847	missense	probably damaging	1.00
R2277:Cdh4	UTSW	2	179797524	missense	possibly damaging	0.88
R3686:Cdh4	UTSW	2	179780367	missense	probably benign	0.09
R3861:Cdh4	UTSW	2	179874097	missense	probably damaging	1.00
R4078:Cdh4	UTSW	2	179889173	missense	possibly damaging	0.93
R4495:Cdh4	UTSW	2	179780389	missense	probably damaging	0.98
R4715:Cdh4	UTSW	2	179780467	missense	probably benign	0.03
R4893:Cdh4	UTSW	2	179847419	intron	probably benign
R5029:Cdh4	UTSW	2	179881949	missense	possibly damaging	0.93
R5363:Cdh4	UTSW	2	179886763	missense	probably benign
R5542:Cdh4	UTSW	2	179860226	missense	probably damaging	0.98
R5773:Cdh4	UTSW	2	179885996	missense	probably damaging	1.00
R5791:Cdh4	UTSW	2	179895767	missense	probably damaging	1.00
R6262:Cdh4	UTSW	2	179797626	missense	probably damaging	1.00
R6338:Cdh4	UTSW	2	179890812	missense	probably damaging	1.00
R6607:Cdh4	UTSW	2	179874096	missense	probably benign	0.00
R6653:Cdh4	UTSW	2	179780428	missense	probably benign	0.34
R6711:Cdh4	UTSW	2	179890931	missense	probably damaging	1.00
R6744:Cdh4	UTSW	2	179847387	missense	possibly damaging	0.68
R6824:Cdh4	UTSW	2	179797558	missense	probably damaging	1.00
R6901:Cdh4	UTSW	2	179860194	missense	probably benign	0.19
R6981:Cdh4	UTSW	2	179797504	missense	probably benign	0.28
R7285:Cdh4	UTSW	2	179797465	missense	probably benign	0.00
R7514:Cdh4	UTSW	2	179890843	missense	possibly damaging	0.91
R7541:Cdh4	UTSW	2	179444810	splice site	probably null
R7560:Cdh4	UTSW	2	179890902	missense	probably benign	0.25
R8146:Cdh4	UTSW	2	179874078	missense	possibly damaging	0.91
R8833:Cdh4	UTSW	2	179894035	missense	possibly damaging	0.61
R9075:Cdh4	UTSW	2	179860147	missense	probably damaging	0.97
R9203:Cdh4	UTSW	2	179780403	missense	probably damaging	0.96
Z1177:Cdh4	UTSW	2	179780326	missense	probably benign	0.45

Predicted Primers

PCR Primer
(F):5'- TTCCTGAGAACCGTATAGAGACAG -3'
(R):5'- CCAGCATGGATATGAAGGCC -3'

Sequencing Primer
(F):5'- GTAGTAGCCAACCTCACGGTGATG -3'
(R):5'- TGGATATGAAGGCCAGAATCTTCCC -3'

Posted On

2018-06-22