Incidental Mutation 'R6597:Rabgef1'
ID524929
Institutional Source Beutler Lab
Gene Symbol Rabgef1
Ensembl Gene ENSMUSG00000025340
Gene NameRAB guanine nucleotide exchange factor (GEF) 1
SynonymsRas negative regulator Rabex-5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.869) question?
Stock #R6597 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location130171798-130214342 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 130191044 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119245 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026390] [ENSMUST00000026390] [ENSMUST00000119027] [ENSMUST00000119027] [ENSMUST00000119797] [ENSMUST00000119797] [ENSMUST00000148264] [ENSMUST00000148264]
Predicted Effect probably null
Transcript: ENSMUST00000026390
SMART Domains Protein: ENSMUSP00000026390
Gene: ENSMUSG00000025340

DomainStartEndE-ValueType
ZnF_A20 16 40 1.5e-12 SMART
low complexity region 56 80 N/A INTRINSIC
low complexity region 82 106 N/A INTRINSIC
VPS9 262 383 1.8e-29 SMART
coiled coil region 411 445 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000026390
SMART Domains Protein: ENSMUSP00000026390
Gene: ENSMUSG00000025340

DomainStartEndE-ValueType
ZnF_A20 16 40 1.5e-12 SMART
low complexity region 56 80 N/A INTRINSIC
low complexity region 82 106 N/A INTRINSIC
VPS9 262 383 1.8e-29 SMART
coiled coil region 411 445 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118998
Predicted Effect probably null
Transcript: ENSMUST00000119027
SMART Domains Protein: ENSMUSP00000112537
Gene: ENSMUSG00000025340

DomainStartEndE-ValueType
ZnF_A20 16 40 2.35e-10 SMART
low complexity region 56 80 N/A INTRINSIC
low complexity region 82 106 N/A INTRINSIC
PDB:1TXU|A 132 221 7e-51 PDB
Predicted Effect probably null
Transcript: ENSMUST00000119027
SMART Domains Protein: ENSMUSP00000112537
Gene: ENSMUSG00000025340

DomainStartEndE-ValueType
ZnF_A20 16 40 2.35e-10 SMART
low complexity region 56 80 N/A INTRINSIC
low complexity region 82 106 N/A INTRINSIC
PDB:1TXU|A 132 221 7e-51 PDB
Predicted Effect probably null
Transcript: ENSMUST00000119797
SMART Domains Protein: ENSMUSP00000114103
Gene: ENSMUSG00000025340

DomainStartEndE-ValueType
ZnF_A20 16 40 1.4e-12 SMART
low complexity region 56 80 N/A INTRINSIC
low complexity region 82 106 N/A INTRINSIC
VPS9 262 383 1.8e-29 SMART
coiled coil region 411 445 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119797
SMART Domains Protein: ENSMUSP00000114103
Gene: ENSMUSG00000025340

DomainStartEndE-ValueType
ZnF_A20 16 40 1.4e-12 SMART
low complexity region 56 80 N/A INTRINSIC
low complexity region 82 106 N/A INTRINSIC
VPS9 262 383 1.8e-29 SMART
coiled coil region 411 445 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143727
Predicted Effect probably null
Transcript: ENSMUST00000148264
SMART Domains Protein: ENSMUSP00000119245
Gene: ENSMUSG00000025340

DomainStartEndE-ValueType
ZnF_A20 16 40 2.35e-10 SMART
low complexity region 56 80 N/A INTRINSIC
low complexity region 82 106 N/A INTRINSIC
PDB:1TXU|A 132 250 1e-72 PDB
Predicted Effect probably null
Transcript: ENSMUST00000148264
SMART Domains Protein: ENSMUSP00000119245
Gene: ENSMUSG00000025340

DomainStartEndE-ValueType
ZnF_A20 16 40 2.35e-10 SMART
low complexity region 56 80 N/A INTRINSIC
low complexity region 82 106 N/A INTRINSIC
PDB:1TXU|A 132 250 1e-72 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202729
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RABGEF1 forms a complex with rabaptin-5 (RABPT5; MIM 603616) that is required for endocytic membrane fusion, and it serves as a specific guanine nucleotide exchange factor (GEF) for RAB5 (RAB5A; MIM 179512) (Horiuchi et al., 1997 [PubMed 9323142]).[supplied by OMIM, Mar 2010]
PHENOTYPE: Nullizygous mutations can cause neonatal or postnatal lethality associated with severe skin inflammation, high mast cell numbers and serum levels of IgE and histamine, and enhanced mast cell degranulation and release of mediators and cytokines in response to high affinity IgE receptor aggregation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik G T 1: 136,226,189 A87E probably damaging Het
A2m A G 6: 121,648,121 Y486C probably damaging Het
Asb17 A T 3: 153,844,684 T118S probably damaging Het
Atl2 T A 17: 79,852,766 D293V possibly damaging Het
Bbs1 T A 19: 4,899,306 M242L probably benign Het
Btg1 T A 10: 96,618,320 S65T probably damaging Het
Cfap54 T C 10: 92,999,040 D1101G possibly damaging Het
Cmpk2 G T 12: 26,474,145 V314L possibly damaging Het
Fbxl8 A C 8: 105,268,891 D345A probably benign Het
Gys2 T A 6: 142,456,309 H268L probably benign Het
Hecw1 T A 13: 14,316,818 R117* probably null Het
Hoxd10 G A 2: 74,692,640 A221T probably benign Het
Hspa13 A T 16: 75,765,197 L38Q probably damaging Het
Ipo11 A G 13: 106,865,863 probably null Het
Itgb8 A G 12: 119,173,398 V390A possibly damaging Het
Kalrn T A 16: 34,182,747 I1370F probably damaging Het
Macf1 T C 4: 123,382,692 N6086S probably damaging Het
Ms4a13 T C 19: 11,192,939 T14A probably benign Het
Olfr1164 A G 2: 88,093,069 F289S probably damaging Het
Olfr1500 T A 19: 13,828,457 probably benign Het
Olfr204 C T 16: 59,315,350 R19H probably benign Het
Olfr545 A T 7: 102,494,421 I118N probably damaging Het
Olfr742 T A 14: 50,515,551 C116S probably benign Het
Olfr911-ps1 A T 9: 38,524,004 I91F probably benign Het
Patl2 T A 2: 122,186,164 probably benign Het
Pcdhga7 T C 18: 37,717,006 S689P probably benign Het
Pitpnc1 G T 11: 107,226,232 Y227* probably null Het
Pla2g2e T C 4: 138,880,673 V22A unknown Het
Ppil1 C A 17: 29,261,878 V24F probably benign Het
Prl3b1 G A 13: 27,247,974 probably null Het
Rhot2 A T 17: 25,840,912 W341R probably damaging Het
Rps6kc1 A T 1: 190,750,184 W286R probably benign Het
Rrs1 A G 1: 9,546,376 T285A probably damaging Het
Shc3 T A 13: 51,442,973 D338V possibly damaging Het
Siglech A T 7: 55,768,463 M60L probably benign Het
Slc12a6 G T 2: 112,352,935 V756F probably damaging Het
Slc43a2 G A 11: 75,571,855 G507D probably damaging Het
Slf1 A G 13: 77,049,129 S789P probably benign Het
Spata31d1d C A 13: 59,726,057 M1221I probably benign Het
Srgap1 T C 10: 121,792,371 N899D probably benign Het
Stag1 G A 9: 100,887,420 M529I probably benign Het
Tekt3 A G 11: 63,081,259 D247G probably benign Het
Tmppe A T 9: 114,405,244 M204L probably benign Het
Tpsg1 G A 17: 25,369,297 probably benign Het
Ttn A G 2: 76,797,971 V6288A probably benign Het
Ttn A T 2: 76,893,100 probably benign Het
Twsg1 C A 17: 65,937,804 V73F probably damaging Het
Vmn2r102 A G 17: 19,694,188 T672A probably damaging Het
Vps36 A G 8: 22,202,304 I66V probably benign Het
Xrcc4 A T 13: 90,000,929 D157E probably benign Het
Zbbx T A 3: 75,136,454 Q162L probably damaging Het
Zfp560 T A 9: 20,348,001 I522L probably benign Het
Zscan20 T C 4: 128,585,746 N984S probably damaging Het
Other mutations in Rabgef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Rabgef1 APN 5 130208724 nonsense probably null
IGL00964:Rabgef1 APN 5 130191022 missense probably damaging 1.00
IGL01830:Rabgef1 APN 5 130212066 missense possibly damaging 0.88
IGL02161:Rabgef1 APN 5 130207099 splice site probably benign
IGL02231:Rabgef1 APN 5 130211975 missense probably damaging 1.00
IGL02429:Rabgef1 APN 5 130210488 missense possibly damaging 0.48
IGL02620:Rabgef1 APN 5 130191022 missense probably damaging 1.00
IGL03005:Rabgef1 APN 5 130208797 missense probably damaging 1.00
LCD18:Rabgef1 UTSW 5 130187586 frame shift probably null
R0227:Rabgef1 UTSW 5 130190990 missense probably damaging 1.00
R1028:Rabgef1 UTSW 5 130212862 nonsense probably null
R1838:Rabgef1 UTSW 5 130213021 missense probably benign 0.01
R2027:Rabgef1 UTSW 5 130208779 missense possibly damaging 0.69
R2074:Rabgef1 UTSW 5 130187561 missense probably benign 0.21
R2079:Rabgef1 UTSW 5 130190935 missense probably damaging 0.99
R2355:Rabgef1 UTSW 5 130212087 missense probably benign 0.29
R3625:Rabgef1 UTSW 5 130212120 critical splice donor site probably null
R3892:Rabgef1 UTSW 5 130208679 splice site probably benign
R5060:Rabgef1 UTSW 5 130212003 missense probably damaging 1.00
R5249:Rabgef1 UTSW 5 130213000 missense probably benign 0.00
R7223:Rabgef1 UTSW 5 130190960 missense probably benign 0.14
R7326:Rabgef1 UTSW 5 130187351 intron probably benign
Predicted Primers PCR Primer
(F):5'- GGACCCAGATCATTCACAGTC -3'
(R):5'- TTCTCCTGCGGAATAAAATGCTTC -3'

Sequencing Primer
(F):5'- GACCCAGATCATTCACAGTCTTTCC -3'
(R):5'- AGAGCTCTCTTGGGCTTA -3'
Posted On2018-06-22