Incidental Mutation 'R6597:Olfr911-ps1'
ID524945
Institutional Source Beutler Lab
Gene Symbol Olfr911-ps1
Ensembl Gene ENSMUSG00000062621
Gene Nameolfactory receptor 911, pseudogene 1
SynonymsMOR165-1, MOR166-1, GA_x6K02T2PVTD-32247224-32248163, GA_x6K02T2PVTD-32223906-32224841, Olfr909
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R6597 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location38521580-38527133 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38524004 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 91 (I91F)
Ref Sequence ENSEMBL: ENSMUSP00000150446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074987] [ENSMUST00000216496]
Predicted Effect probably benign
Transcript: ENSMUST00000074987
AA Change: I91F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000074515
Gene: ENSMUSG00000062621
AA Change: I91F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.2e-46 PFAM
Pfam:7tm_1 41 290 9.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216496
AA Change: I91F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik G T 1: 136,226,189 A87E probably damaging Het
A2m A G 6: 121,648,121 Y486C probably damaging Het
Asb17 A T 3: 153,844,684 T118S probably damaging Het
Atl2 T A 17: 79,852,766 D293V possibly damaging Het
Bbs1 T A 19: 4,899,306 M242L probably benign Het
Btg1 T A 10: 96,618,320 S65T probably damaging Het
Cfap54 T C 10: 92,999,040 D1101G possibly damaging Het
Cmpk2 G T 12: 26,474,145 V314L possibly damaging Het
Fbxl8 A C 8: 105,268,891 D345A probably benign Het
Gys2 T A 6: 142,456,309 H268L probably benign Het
Hecw1 T A 13: 14,316,818 R117* probably null Het
Hoxd10 G A 2: 74,692,640 A221T probably benign Het
Hspa13 A T 16: 75,765,197 L38Q probably damaging Het
Ipo11 A G 13: 106,865,863 probably null Het
Itgb8 A G 12: 119,173,398 V390A possibly damaging Het
Kalrn T A 16: 34,182,747 I1370F probably damaging Het
Macf1 T C 4: 123,382,692 N6086S probably damaging Het
Ms4a13 T C 19: 11,192,939 T14A probably benign Het
Olfr1164 A G 2: 88,093,069 F289S probably damaging Het
Olfr1500 T A 19: 13,828,457 probably benign Het
Olfr204 C T 16: 59,315,350 R19H probably benign Het
Olfr545 A T 7: 102,494,421 I118N probably damaging Het
Olfr742 T A 14: 50,515,551 C116S probably benign Het
Patl2 T A 2: 122,186,164 probably benign Het
Pcdhga7 T C 18: 37,717,006 S689P probably benign Het
Pitpnc1 G T 11: 107,226,232 Y227* probably null Het
Pla2g2e T C 4: 138,880,673 V22A unknown Het
Ppil1 C A 17: 29,261,878 V24F probably benign Het
Prl3b1 G A 13: 27,247,974 probably null Het
Rabgef1 G A 5: 130,191,044 probably null Het
Rhot2 A T 17: 25,840,912 W341R probably damaging Het
Rps6kc1 A T 1: 190,750,184 W286R probably benign Het
Rrs1 A G 1: 9,546,376 T285A probably damaging Het
Shc3 T A 13: 51,442,973 D338V possibly damaging Het
Siglech A T 7: 55,768,463 M60L probably benign Het
Slc12a6 G T 2: 112,352,935 V756F probably damaging Het
Slc43a2 G A 11: 75,571,855 G507D probably damaging Het
Slf1 A G 13: 77,049,129 S789P probably benign Het
Spata31d1d C A 13: 59,726,057 M1221I probably benign Het
Srgap1 T C 10: 121,792,371 N899D probably benign Het
Stag1 G A 9: 100,887,420 M529I probably benign Het
Tekt3 A G 11: 63,081,259 D247G probably benign Het
Tmppe A T 9: 114,405,244 M204L probably benign Het
Tpsg1 G A 17: 25,369,297 probably benign Het
Ttn A G 2: 76,797,971 V6288A probably benign Het
Ttn A T 2: 76,893,100 probably benign Het
Twsg1 C A 17: 65,937,804 V73F probably damaging Het
Vmn2r102 A G 17: 19,694,188 T672A probably damaging Het
Vps36 A G 8: 22,202,304 I66V probably benign Het
Xrcc4 A T 13: 90,000,929 D157E probably benign Het
Zbbx T A 3: 75,136,454 Q162L probably damaging Het
Zfp560 T A 9: 20,348,001 I522L probably benign Het
Zscan20 T C 4: 128,585,746 N984S probably damaging Het
Other mutations in Olfr911-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Olfr911-ps1 APN 9 38523733 utr 5 prime probably benign
IGL02319:Olfr911-ps1 APN 9 38523870 missense probably damaging 0.97
IGL02415:Olfr911-ps1 APN 9 38524112 missense probably benign 0.42
IGL02536:Olfr911-ps1 APN 9 38524164 missense probably damaging 1.00
IGL02702:Olfr911-ps1 APN 9 38524560 missense probably damaging 1.00
IGL02926:Olfr911-ps1 APN 9 38523725 utr 5 prime probably benign
R0499:Olfr911-ps1 UTSW 9 38524505 missense probably benign 0.01
R0662:Olfr911-ps1 UTSW 9 38524026 missense probably damaging 0.99
R0799:Olfr911-ps1 UTSW 9 38524141 missense probably benign 0.01
R1186:Olfr911-ps1 UTSW 9 38524157 missense probably damaging 0.97
R1681:Olfr911-ps1 UTSW 9 38524117 missense probably benign 0.03
R3522:Olfr911-ps1 UTSW 9 38523785 missense probably damaging 1.00
R5820:Olfr911-ps1 UTSW 9 38524599 missense possibly damaging 0.52
R7721:Olfr911-ps1 UTSW 9 38523717 critical splice acceptor site probably null
R7846:Olfr911-ps1 UTSW 9 38524379 missense probably benign 0.00
R7985:Olfr911-ps1 UTSW 9 38523943 missense probably damaging 1.00
R8339:Olfr911-ps1 UTSW 9 38524421 missense probably damaging 1.00
Z1088:Olfr911-ps1 UTSW 9 38523859 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACACAACAACAGCAGTGGG -3'
(R):5'- AAGGTCAGTCTCAGAATGCATCC -3'

Sequencing Primer
(F):5'- CAGCAGTGGGGAATTTGGC -3'
(R):5'- TCCAGTGTGAATCATGGCAC -3'
Posted On2018-06-22