Incidental Mutation 'R6597:Rrs1'
ID524905
Institutional Source Beutler Lab
Gene Symbol Rrs1
Ensembl Gene ENSMUSG00000061024
Gene Nameribosome biogenesis regulator 1
Synonyms5730466A07Rik, D1Ertd701e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6597 (G1)
Quality Score135.008
Status Validated
Chromosome1
Chromosomal Location9545408-9547455 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9546376 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 285 (T285A)
Ref Sequence ENSEMBL: ENSMUSP00000071955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027044] [ENSMUST00000072079] [ENSMUST00000130927] [ENSMUST00000144177] [ENSMUST00000186467]
Predicted Effect probably benign
Transcript: ENSMUST00000027044
Predicted Effect probably damaging
Transcript: ENSMUST00000072079
AA Change: T285A

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000071955
Gene: ENSMUSG00000061024
AA Change: T285A

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
Pfam:RRS1 31 193 3.5e-62 PFAM
low complexity region 302 337 N/A INTRINSIC
low complexity region 351 365 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130927
Predicted Effect probably benign
Transcript: ENSMUST00000144177
SMART Domains Protein: ENSMUSP00000116627
Gene: ENSMUSG00000025911

DomainStartEndE-ValueType
Pfam:Fe-ADH 50 454 2.1e-105 PFAM
Pfam:Fe-ADH_2 53 155 6.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186467
Predicted Effect probably benign
Transcript: ENSMUST00000190654
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik G T 1: 136,226,189 A87E probably damaging Het
A2m A G 6: 121,648,121 Y486C probably damaging Het
Asb17 A T 3: 153,844,684 T118S probably damaging Het
Atl2 T A 17: 79,852,766 D293V possibly damaging Het
Bbs1 T A 19: 4,899,306 M242L probably benign Het
Btg1 T A 10: 96,618,320 S65T probably damaging Het
Cfap54 T C 10: 92,999,040 D1101G possibly damaging Het
Cmpk2 G T 12: 26,474,145 V314L possibly damaging Het
Fbxl8 A C 8: 105,268,891 D345A probably benign Het
Gys2 T A 6: 142,456,309 H268L probably benign Het
Hecw1 T A 13: 14,316,818 R117* probably null Het
Hoxd10 G A 2: 74,692,640 A221T probably benign Het
Hspa13 A T 16: 75,765,197 L38Q probably damaging Het
Ipo11 A G 13: 106,865,863 probably null Het
Itgb8 A G 12: 119,173,398 V390A possibly damaging Het
Kalrn T A 16: 34,182,747 I1370F probably damaging Het
Macf1 T C 4: 123,382,692 N6086S probably damaging Het
Ms4a13 T C 19: 11,192,939 T14A probably benign Het
Olfr1164 A G 2: 88,093,069 F289S probably damaging Het
Olfr1500 T A 19: 13,828,457 probably benign Het
Olfr204 C T 16: 59,315,350 R19H probably benign Het
Olfr545 A T 7: 102,494,421 I118N probably damaging Het
Olfr742 T A 14: 50,515,551 C116S probably benign Het
Olfr911-ps1 A T 9: 38,524,004 I91F probably benign Het
Patl2 T A 2: 122,186,164 probably benign Het
Pcdhga7 T C 18: 37,717,006 S689P probably benign Het
Pitpnc1 G T 11: 107,226,232 Y227* probably null Het
Pla2g2e T C 4: 138,880,673 V22A unknown Het
Ppil1 C A 17: 29,261,878 V24F probably benign Het
Prl3b1 G A 13: 27,247,974 probably null Het
Rabgef1 G A 5: 130,191,044 probably null Het
Rhot2 A T 17: 25,840,912 W341R probably damaging Het
Rps6kc1 A T 1: 190,750,184 W286R probably benign Het
Shc3 T A 13: 51,442,973 D338V possibly damaging Het
Siglech A T 7: 55,768,463 M60L probably benign Het
Slc12a6 G T 2: 112,352,935 V756F probably damaging Het
Slc43a2 G A 11: 75,571,855 G507D probably damaging Het
Slf1 A G 13: 77,049,129 S789P probably benign Het
Spata31d1d C A 13: 59,726,057 M1221I probably benign Het
Srgap1 T C 10: 121,792,371 N899D probably benign Het
Stag1 G A 9: 100,887,420 M529I probably benign Het
Tekt3 A G 11: 63,081,259 D247G probably benign Het
Tmppe A T 9: 114,405,244 M204L probably benign Het
Tpsg1 G A 17: 25,369,297 probably benign Het
Ttn A G 2: 76,797,971 V6288A probably benign Het
Ttn A T 2: 76,893,100 probably benign Het
Twsg1 C A 17: 65,937,804 V73F probably damaging Het
Vmn2r102 A G 17: 19,694,188 T672A probably damaging Het
Vps36 A G 8: 22,202,304 I66V probably benign Het
Xrcc4 A T 13: 90,000,929 D157E probably benign Het
Zbbx T A 3: 75,136,454 Q162L probably damaging Het
Zfp560 T A 9: 20,348,001 I522L probably benign Het
Zscan20 T C 4: 128,585,746 N984S probably damaging Het
Other mutations in Rrs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03098:Rrs1 UTSW 1 9546103 frame shift probably null
PIT1430001:Rrs1 UTSW 1 9545925 missense probably damaging 1.00
R0207:Rrs1 UTSW 1 9545762 splice site probably null
R0207:Rrs1 UTSW 1 9545767 missense probably damaging 0.96
R0577:Rrs1 UTSW 1 9545801 splice site probably null
R1165:Rrs1 UTSW 1 9545767 missense probably damaging 0.96
R1222:Rrs1 UTSW 1 9545855 missense probably benign 0.00
R1238:Rrs1 UTSW 1 9545801 splice site probably null
R1397:Rrs1 UTSW 1 9545767 missense probably damaging 0.96
R1598:Rrs1 UTSW 1 9545912 missense probably benign 0.15
R2338:Rrs1 UTSW 1 9545801 splice site probably null
R4280:Rrs1 UTSW 1 9546139 missense probably damaging 0.96
R4287:Rrs1 UTSW 1 9546215 missense probably damaging 1.00
R4287:Rrs1 UTSW 1 9546223 missense possibly damaging 0.82
R4298:Rrs1 UTSW 1 9546223 missense possibly damaging 0.82
R4326:Rrs1 UTSW 1 9546341 missense possibly damaging 0.95
R4475:Rrs1 UTSW 1 9545585 missense probably damaging 1.00
R4566:Rrs1 UTSW 1 9546227 missense probably damaging 1.00
R4986:Rrs1 UTSW 1 9545767 missense probably damaging 0.96
R7529:Rrs1 UTSW 1 9546192 missense probably benign
R7728:Rrs1 UTSW 1 9546398 missense possibly damaging 0.78
R8134:Rrs1 UTSW 1 9545420 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AAGTGGCCAAGGTTTCCACC -3'
(R):5'- TTTCAGAACTGGTCCCGAGG -3'

Sequencing Primer
(F):5'- TCTTTGGGGACTTCGCA -3'
(R):5'- TCTTCTTGCCAGCTAAAGCAGAAG -3'
Posted On2018-06-22