Incidental Mutation 'R6640:Raver2'
ID525710
Institutional Source Beutler Lab
Gene Symbol Raver2
Ensembl Gene ENSMUSG00000035275
Gene Nameribonucleoprotein, PTB-binding 2
SynonymsA430091O22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R6640 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location101068983-101152370 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 101131303 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 371 (P371L)
Ref Sequence ENSEMBL: ENSMUSP00000043142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038463] [ENSMUST00000106955]
Predicted Effect probably damaging
Transcript: ENSMUST00000038463
AA Change: P371L

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043142
Gene: ENSMUSG00000035275
AA Change: P371L

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
RRM 59 125 8.2e-11 SMART
RRM 132 205 1.67e-11 SMART
RRM 221 294 2.12e-4 SMART
low complexity region 362 379 N/A INTRINSIC
low complexity region 499 512 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106955
AA Change: P371L

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102568
Gene: ENSMUSG00000035275
AA Change: P371L

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
RRM 59 125 8.2e-11 SMART
RRM 132 205 1.67e-11 SMART
RRM 221 294 2.12e-4 SMART
low complexity region 362 379 N/A INTRINSIC
Meta Mutation Damage Score 0.2555 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 97% (31/32)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,553,285 N936K probably benign Het
Abca2 A T 2: 25,447,003 Y2318F possibly damaging Het
Aldh1b1 A G 4: 45,803,868 T469A possibly damaging Het
Ccdc136 A G 6: 29,412,960 D382G possibly damaging Het
Dapk1 A G 13: 60,716,814 K141E probably damaging Het
Dnah6 A T 6: 73,024,293 W3973R probably damaging Het
Dock10 G T 1: 80,533,838 S1518* probably null Het
Doxl2 A G 6: 48,977,671 D581G probably benign Het
Elovl5 C A 9: 77,979,913 Y195* probably null Het
Fbxl21 T A 13: 56,537,009 W309R probably damaging Het
Gm10020 G T 15: 52,477,620 noncoding transcript Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gpx1 A G 9: 108,340,096 D133G probably damaging Het
Hoxd1 T A 2: 74,763,262 V54E probably damaging Het
Kcnh3 T C 15: 99,241,768 V876A probably benign Het
Klri2 G C 6: 129,732,195 F231L probably benign Het
Mogat1 T G 1: 78,523,774 S158R probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Olfr1008 T A 2: 85,689,935 C169S probably damaging Het
Olfr695 T A 7: 106,714,040 I214F probably damaging Het
Otog G A 7: 46,261,743 A673T possibly damaging Het
Pigm T C 1: 172,377,687 V330A probably damaging Het
Rab33b A G 3: 51,484,479 T50A possibly damaging Het
Sh3rf2 T A 18: 42,101,640 Y163N probably damaging Het
Slc1a1 T C 19: 28,894,570 probably null Het
Slc6a18 T A 13: 73,664,282 Y563F possibly damaging Het
Sp3 A G 2: 72,971,114 L185P possibly damaging Het
Thbs2 T C 17: 14,673,368 D850G possibly damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmtc2 T A 10: 105,573,749 M1L probably benign Het
Trpm2 C T 10: 77,937,826 R585Q probably benign Het
Trpm3 T A 19: 22,978,582 I1126K probably damaging Het
Ugt1a6b A C 1: 88,107,794 T285P probably benign Het
Vps13b A G 15: 35,617,696 T1181A possibly damaging Het
Other mutations in Raver2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Raver2 APN 4 101102868 missense probably damaging 1.00
IGL00778:Raver2 APN 4 101096271 missense probably benign 0.00
IGL01363:Raver2 APN 4 101120583 splice site probably benign
IGL02631:Raver2 APN 4 101096302 missense probably damaging 0.96
R0071:Raver2 UTSW 4 101120445 splice site probably benign
R0071:Raver2 UTSW 4 101120445 splice site probably benign
R0792:Raver2 UTSW 4 101102950 missense probably damaging 1.00
R1450:Raver2 UTSW 4 101136152 missense possibly damaging 0.58
R2044:Raver2 UTSW 4 101102812 missense probably damaging 1.00
R5127:Raver2 UTSW 4 101102985 missense probably damaging 1.00
R5162:Raver2 UTSW 4 101102724 missense probably damaging 1.00
R5342:Raver2 UTSW 4 101102692 missense possibly damaging 0.47
R5557:Raver2 UTSW 4 101136139 missense probably benign 0.04
R6190:Raver2 UTSW 4 101133617 missense probably benign 0.00
R6248:Raver2 UTSW 4 101134123 splice site probably null
R6449:Raver2 UTSW 4 101133672 missense probably benign 0.41
R6852:Raver2 UTSW 4 101133590 missense probably benign 0.00
R7196:Raver2 UTSW 4 101102859 missense probably damaging 1.00
R7449:Raver2 UTSW 4 101102663 missense probably damaging 1.00
R7459:Raver2 UTSW 4 101107213 missense possibly damaging 0.83
R8025:Raver2 UTSW 4 101102965 nonsense probably null
RF017:Raver2 UTSW 4 101102998 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATTCCAGGATCGAATTGCCAGG -3'
(R):5'- GCTCAATTAACTTCTTGATGAGGTC -3'

Sequencing Primer
(F):5'- TCGAATTGCCAGGAGATGCTG -3'
(R):5'- AGGTCTGGCACACTGGTAAATTCC -3'
Posted On2018-06-22