Incidental Mutation 'R6640:Mogat1'
ID525693
Institutional Source Beutler Lab
Gene Symbol Mogat1
Ensembl Gene ENSMUSG00000012187
Gene Namemonoacylglycerol O-acyltransferase 1
Synonyms1110064N14Rik, mDC2, 0610030A14Rik, Dgat2l1, MGAT1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R6640 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location78510991-78538173 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 78523774 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 158 (S158R)
Ref Sequence ENSEMBL: ENSMUSP00000109152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012331] [ENSMUST00000113524] [ENSMUST00000134947] [ENSMUST00000149732] [ENSMUST00000152111]
Predicted Effect probably damaging
Transcript: ENSMUST00000012331
AA Change: S158R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000012331
Gene: ENSMUSG00000012187
AA Change: S158R

DomainStartEndE-ValueType
Pfam:DAGAT 40 335 3.2e-117 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113524
AA Change: S158R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109152
Gene: ENSMUSG00000012187
AA Change: S158R

DomainStartEndE-ValueType
Pfam:DAGAT 40 335 3.2e-117 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000134947
AA Change: S158R

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116178
Gene: ENSMUSG00000012187
AA Change: S158R

DomainStartEndE-ValueType
Pfam:DAGAT 40 201 2.9e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000149732
AA Change: S127R

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000117903
Gene: ENSMUSG00000012187
AA Change: S127R

DomainStartEndE-ValueType
Pfam:DAGAT 9 247 3.4e-91 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152111
SMART Domains Protein: ENSMUSP00000123427
Gene: ENSMUSG00000012187

DomainStartEndE-ValueType
Pfam:DAGAT 40 82 1.9e-9 PFAM
Meta Mutation Damage Score 0.3637 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acyl-CoA:monoacylglycerol acyltransferase (MOGAT; EC 2.3.1.22) catalyzes the synthesis of diacylglycerols, the precursor of physiologically important lipids such as triacylglycerol and phospholipids (Yen et al., 2002 [PubMed 12077311]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased body weight in female, but not, male mice and does not ameliorate hepatic steatosis in lipodystrophic or obese mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,553,285 N936K probably benign Het
Abca2 A T 2: 25,447,003 Y2318F possibly damaging Het
Aldh1b1 A G 4: 45,803,868 T469A possibly damaging Het
Ccdc136 A G 6: 29,412,960 D382G possibly damaging Het
Dapk1 A G 13: 60,716,814 K141E probably damaging Het
Dnah6 A T 6: 73,024,293 W3973R probably damaging Het
Dock10 G T 1: 80,533,838 S1518* probably null Het
Doxl2 A G 6: 48,977,671 D581G probably benign Het
Elovl5 C A 9: 77,979,913 Y195* probably null Het
Fbxl21 T A 13: 56,537,009 W309R probably damaging Het
Gm10020 G T 15: 52,477,620 noncoding transcript Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gpx1 A G 9: 108,340,096 D133G probably damaging Het
Hoxd1 T A 2: 74,763,262 V54E probably damaging Het
Kcnh3 T C 15: 99,241,768 V876A probably benign Het
Klri2 G C 6: 129,732,195 F231L probably benign Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Olfr1008 T A 2: 85,689,935 C169S probably damaging Het
Olfr695 T A 7: 106,714,040 I214F probably damaging Het
Otog G A 7: 46,261,743 A673T possibly damaging Het
Pigm T C 1: 172,377,687 V330A probably damaging Het
Rab33b A G 3: 51,484,479 T50A possibly damaging Het
Raver2 C T 4: 101,131,303 P371L probably damaging Het
Sh3rf2 T A 18: 42,101,640 Y163N probably damaging Het
Slc1a1 T C 19: 28,894,570 probably null Het
Slc6a18 T A 13: 73,664,282 Y563F possibly damaging Het
Sp3 A G 2: 72,971,114 L185P possibly damaging Het
Thbs2 T C 17: 14,673,368 D850G possibly damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmtc2 T A 10: 105,573,749 M1L probably benign Het
Trpm2 C T 10: 77,937,826 R585Q probably benign Het
Trpm3 T A 19: 22,978,582 I1126K probably damaging Het
Ugt1a6b A C 1: 88,107,794 T285P probably benign Het
Vps13b A G 15: 35,617,696 T1181A possibly damaging Het
Other mutations in Mogat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0056:Mogat1 UTSW 1 78523770 missense probably damaging 0.99
R0056:Mogat1 UTSW 1 78523770 missense probably damaging 0.99
R0105:Mogat1 UTSW 1 78523670 missense probably benign 0.17
R0105:Mogat1 UTSW 1 78523670 missense probably benign 0.17
R0357:Mogat1 UTSW 1 78512040 missense probably benign 0.01
R1146:Mogat1 UTSW 1 78523613 missense probably benign 0.09
R1146:Mogat1 UTSW 1 78523613 missense probably benign 0.09
R1716:Mogat1 UTSW 1 78538044 missense probably benign 0.01
R3799:Mogat1 UTSW 1 78529138 missense probably benign 0.00
R4168:Mogat1 UTSW 1 78512035 missense possibly damaging 0.77
R5485:Mogat1 UTSW 1 78523670 missense probably benign 0.17
R5929:Mogat1 UTSW 1 78523733 missense probably benign 0.00
R6841:Mogat1 UTSW 1 78522859 missense probably damaging 1.00
R7842:Mogat1 UTSW 1 78522865 critical splice donor site probably null
R8179:Mogat1 UTSW 1 78527618 missense possibly damaging 0.58
Z1177:Mogat1 UTSW 1 78529253 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTCTACGTGAACATGCTGTAGC -3'
(R):5'- TCCACAGAGCATAGGAAGTGTAAC -3'

Sequencing Primer
(F):5'- GCTGTAGCTTGTCAAAACGC -3'
(R):5'- GAAGTGTAACATCAAGCAACTGC -3'
Posted On2018-06-22