Incidental Mutation 'R6640:Gpx1'
ID525726
Institutional Source Beutler Lab
Gene Symbol Gpx1
Ensembl Gene ENSMUSG00000063856
Gene Nameglutathione peroxidase 1
SynonymsGPx-1, GSHPx-1, Gpx, CGPx, cellular GPx
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6640 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location108338903-108340343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108340096 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 133 (D133G)
Ref Sequence ENSEMBL: ENSMUSP00000141279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007959] [ENSMUST00000082429] [ENSMUST00000191997] [ENSMUST00000193987] [ENSMUST00000194701]
Predicted Effect probably benign
Transcript: ENSMUST00000007959
SMART Domains Protein: ENSMUSP00000007959
Gene: ENSMUSG00000007815

DomainStartEndE-ValueType
RHO 8 181 1.09e-134 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000082429
AA Change: D189G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081010
Gene: ENSMUSG00000063856
AA Change: D189G

DomainStartEndE-ValueType
Pfam:GSHPx 14 128 5.6e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191997
AA Change: D132G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142257
Gene: ENSMUSG00000063856
AA Change: D132G

DomainStartEndE-ValueType
Pfam:GSHPx 1 71 3.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192053
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192401
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193424
Predicted Effect probably damaging
Transcript: ENSMUST00000193987
AA Change: D133G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141279
Gene: ENSMUSG00000063856
AA Change: D133G

DomainStartEndE-ValueType
Pfam:GSHPx 1 72 6.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194701
SMART Domains Protein: ENSMUSP00000141967
Gene: ENSMUSG00000007815

DomainStartEndE-ValueType
RHO 8 165 8.9e-117 SMART
Meta Mutation Damage Score 0.6428 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of organic hydroperoxides and hydrogen peroxide (H2O2) by glutathione, and thereby protect cells against oxidative damage. Knockout mice lacking this gene are highly sensitive to oxidants, and develop mature cataracts due to damage to the eye lens nucleus. Other studies indicate that H2O2 is also essential for growth-factor mediated signal transduction, mitochondrial function, and maintenance of thiol redox-balance; therefore, by limiting H2O2 accumulation, glutathione peroxidases are also involved in modulating these processes. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. This isozyme is the most abundant, is ubiquitously expressed and localized in the cytoplasm, and whose preferred substrate is hydrogen peroxide. It is also a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for targeted null mutations show increased sensitivity to the oxidative stress agents paraquat and hydrogen peroxide and to ischemia/reperfusion and cold-induced brain injury. Mutants also show paradoxical bradykinin-induced vasoconstriction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,553,285 N936K probably benign Het
Abca2 A T 2: 25,447,003 Y2318F possibly damaging Het
Aldh1b1 A G 4: 45,803,868 T469A possibly damaging Het
Ccdc136 A G 6: 29,412,960 D382G possibly damaging Het
Dapk1 A G 13: 60,716,814 K141E probably damaging Het
Dnah6 A T 6: 73,024,293 W3973R probably damaging Het
Dock10 G T 1: 80,533,838 S1518* probably null Het
Doxl2 A G 6: 48,977,671 D581G probably benign Het
Elovl5 C A 9: 77,979,913 Y195* probably null Het
Fbxl21 T A 13: 56,537,009 W309R probably damaging Het
Gm10020 G T 15: 52,477,620 noncoding transcript Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Hoxd1 T A 2: 74,763,262 V54E probably damaging Het
Kcnh3 T C 15: 99,241,768 V876A probably benign Het
Klri2 G C 6: 129,732,195 F231L probably benign Het
Mogat1 T G 1: 78,523,774 S158R probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Olfr1008 T A 2: 85,689,935 C169S probably damaging Het
Olfr695 T A 7: 106,714,040 I214F probably damaging Het
Otog G A 7: 46,261,743 A673T possibly damaging Het
Pigm T C 1: 172,377,687 V330A probably damaging Het
Rab33b A G 3: 51,484,479 T50A possibly damaging Het
Raver2 C T 4: 101,131,303 P371L probably damaging Het
Sh3rf2 T A 18: 42,101,640 Y163N probably damaging Het
Slc1a1 T C 19: 28,894,570 probably null Het
Slc6a18 T A 13: 73,664,282 Y563F possibly damaging Het
Sp3 A G 2: 72,971,114 L185P possibly damaging Het
Thbs2 T C 17: 14,673,368 D850G possibly damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmtc2 T A 10: 105,573,749 M1L probably benign Het
Trpm2 C T 10: 77,937,826 R585Q probably benign Het
Trpm3 T A 19: 22,978,582 I1126K probably damaging Het
Ugt1a6b A C 1: 88,107,794 T285P probably benign Het
Vps13b A G 15: 35,617,696 T1181A possibly damaging Het
Other mutations in Gpx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1692:Gpx1 UTSW 9 108339475 missense possibly damaging 0.95
R1833:Gpx1 UTSW 9 108339356 missense possibly damaging 0.89
R3442:Gpx1 UTSW 9 108339350 missense probably benign
R4864:Gpx1 UTSW 9 108339395 missense probably benign 0.35
R6838:Gpx1 UTSW 9 108339940 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TTACCTTCCTGCGGAATGCC -3'
(R):5'- TCATTAGGTGGAAAGGCATCGG -3'

Sequencing Primer
(F):5'- TGCGGAATGCCTTGCCAAC -3'
(R):5'- AATGGATGGGACCAGCGCC -3'
Posted On2018-06-22